Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • adaptor/barcode trimming that are NOT in the 5' or 3' end

    Hi,

    Is there any tool available that allows to trim adapter (and primers) that are inside of the reads (not in the 5' or 3' ends)?

    For whatever reason a portion of my reads have a variable number of random bases before the adapter and primer. I need a tool that is able to trim the adapter+primer and any bases before it (this is between the 5'end and the adapter). I need to do the same for the 3'ends, where I have the same issue.

    This is an example of such a read. In red are the adapter and primer sequences. After trimming, only the lower case portion should remain:

    >made-up example
    ATCGTAGTATTAGGATCGTCGCTGATGACTGAatgatgatagttacctagagcta[...]cgacatcacgaccccgatagaATAGCTAGCTATCGATCGATCTGACATAGACA

    A custom script would do it as well. I tried using the bash tool grep, but wasn't able to make it work.

    These sequences are amplicons generated using barcoded COI primers in PacBIO (with the Conserved Consensus Sequencing protocol). When I say adapter I mean the barcode that was added to the primers to be able to split the libraries.

    Thanks in advance for your answers.

    Iria

  • #2
    Agrep

    agrep, a fuzzy grep version:


    best implemeted in TRE:
    http://en.wikipedia.org/wiki/TRE_(computing)

    Comment


    • #3
      Skewer

      Suppose the content of test.fasta is:

      >made-up example
      ATCGTAGTATTAGGATCGTCGCTGATGACTGAatgatgatagttacctagagctaGAGACCGCCT
      GGGAATACCGGGTGCTGTAGGCTTTGGAATTCcgacatcacgaccccgatagaATAGCTAGCTA
      TCGATC
      GATCTGACATAGACA

      and you use the following command:
      $ cat test.fasta | skewer -x ATAGCTAGCTATCGATC -e 3 - -1 2>/dev/null | skewer -x ATTAGGATCGTCGCTGATGACTGA -e 5 - -1 2>/dev/null

      you will get the following result:

      >made-up example
      atgatgatagttacctagagctaGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTTTGGAATTCcgacatcacgaccccgataga

      where ATAGCTAGCTATCGATC is the 3' end adapter sequence; ATTAGGATCGTCGCTGATGACTGA is the 5' end adapter sequence.

      See http://seqanswers.com/forums/showthr...ghlight=skewer for more details.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Recent Advances in Sequencing Analysis Tools
        by seqadmin


        The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
        05-06-2024, 07:48 AM
      • seqadmin
        Essential Discoveries and Tools in Epitranscriptomics
        by seqadmin




        The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
        04-22-2024, 07:01 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 05-14-2024, 07:03 AM
      0 responses
      19 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-10-2024, 06:35 AM
      0 responses
      44 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-09-2024, 02:46 PM
      0 responses
      54 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-07-2024, 06:57 AM
      0 responses
      42 views
      0 likes
      Last Post seqadmin  
      Working...
      X