Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • relipmoc
    replied
    Skewer

    Suppose the content of test.fasta is:

    >made-up example
    ATCGTAGTATTAGGATCGTCGCTGATGACTGAatgatgatagttacctagagctaGAGACCGCCT
    GGGAATACCGGGTGCTGTAGGCTTTGGAATTCcgacatcacgaccccgatagaATAGCTAGCTA
    TCGATC
    GATCTGACATAGACA

    and you use the following command:
    $ cat test.fasta | skewer -x ATAGCTAGCTATCGATC -e 3 - -1 2>/dev/null | skewer -x ATTAGGATCGTCGCTGATGACTGA -e 5 - -1 2>/dev/null

    you will get the following result:

    >made-up example
    atgatgatagttacctagagctaGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTTTGGAATTCcgacatcacgaccccgataga

    where ATAGCTAGCTATCGATC is the 3' end adapter sequence; ATTAGGATCGTCGCTGATGACTGA is the 5' end adapter sequence.

    See http://seqanswers.com/forums/showthr...ghlight=skewer for more details.

    Leave a comment:


  • dietmar13
    replied
    Agrep

    agrep, a fuzzy grep version:


    best implemeted in TRE:
    http://en.wikipedia.org/wiki/TRE_(computing)

    Leave a comment:


  • adaptor/barcode trimming that are NOT in the 5' or 3' end

    Hi,

    Is there any tool available that allows to trim adapter (and primers) that are inside of the reads (not in the 5' or 3' ends)?

    For whatever reason a portion of my reads have a variable number of random bases before the adapter and primer. I need a tool that is able to trim the adapter+primer and any bases before it (this is between the 5'end and the adapter). I need to do the same for the 3'ends, where I have the same issue.

    This is an example of such a read. In red are the adapter and primer sequences. After trimming, only the lower case portion should remain:

    >made-up example
    ATCGTAGTATTAGGATCGTCGCTGATGACTGAatgatgatagttacctagagcta[...]cgacatcacgaccccgatagaATAGCTAGCTATCGATCGATCTGACATAGACA

    A custom script would do it as well. I tried using the bash tool grep, but wasn't able to make it work.

    These sequences are amplicons generated using barcoded COI primers in PacBIO (with the Conserved Consensus Sequencing protocol). When I say adapter I mean the barcode that was added to the primers to be able to split the libraries.

    Thanks in advance for your answers.

    Iria

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-17-2024, 06:54 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
20 views
0 likes
Last Post seqadmin  
Working...
X