Header Leaderboard Ad

Collapse

Bioscope sam output

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bioscope sam output

    Does anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?
    Last edited by damiankao; 03-22-2010, 07:17 AM.

  • #2
    Originally posted by damiankao View Post
    Does anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?
    Mapping quality is between 0 and 255.

    Comment


    • #3
      Originally posted by damiankao View Post
      Does anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?
      what version of BS are you using? Those that version dumps BAMs directly or you have to postprocess to convert to BAM/SAM?

      Can you dump some entries from your BAM?
      -drd

      Comment


      • #4
        I am using the version that dumps .bam. Then I post-process to .sam and cleaned it up for cufflinks.

        Here's a few entries with really low scores.
        Code:
        1847_606_2027	256	Contig78899	2917	0	31M19H	*	0	0	TGAATGACCTTGACCTACTTTTCAATGACCT	DIFE>DIII'&->E4AIHFH;.:IIFAFID2	XS:A:+
        763_1093_180	256	Contig78899	2917	1	34M16H	*	0	0	TGAATGACCTTGACCTACTTTTCAATGACCTTGA	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII:H	XS:A:+
        955_1354_927	256	Contig78899	2917	1	27M23H	*	0	0	TGAATGACCTTGACCTACTTTTCAATG	77CIEEIIIIHFDIIIHGIIIDIIIA1	XS:A:+
        1347_1328_414	256	Contig78899	2919	0	15H31M4H	*	0	0	AATGACCTTGACCTACTTTTCAATGACCTTG	EAIIIIE<0:%%II>FIIIIIIIIIIIIDII	XS:A:+
        1062_1345_1564	272	Contig78899	2919	0	21H29M	*	0	0	AATGACCTTGACCTACTTTTCAATGACCT	I6EIII&&IIIGIIIII=>I>%%:IIICI	XS:A:-
        1648_875_1465	272	Contig78899	2921	0	22H28M	*	0	0	TGACCTTGACCTACTTTTCAATGACCTT	"7G7*-;FE<1AI=4##IIIIIIIIIII	XS:A:-
        1314_701_16	272	Contig78899	2922	0	23H27M	*	0	0	GACCTTGACCTACTTTTCAATGACCTT	%+1,-6C%%.*5##7:IIIIIIIIIII	XS:A:-
        1551_763_1651	272	Contig78899	2922	0	23H27M	*	0	0	GACCTTGACCTACTTTTCAATGACCTT	"I=,2CIF>$$;>70DIIIIIIIIIII	XS:A:-
        1238_1512_669	272	Contig78899	2940	0	24H26M	*	0	0	AATGACCTTGAAAAATTATGATGAGT	IGIIIIIIIIIII==I><IIIIIIII	XS:A:-

        Comment


        • #5
          Any chance you can tell us the version you are using?

          Also, is there any parameter to make the bam store the original CS calls?
          -drd

          Comment

          Latest Articles

          Collapse

          • seqadmin
            A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
            by seqadmin


            ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

            01-24-2023, 01:19 PM
          • seqadmin
            Introduction to Single-Cell Sequencing
            by seqadmin
            Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

            The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
            ...
            01-09-2023, 03:10 PM

          ad_right_rmr

          Collapse
          Working...
          X