Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • dpryan
    replied
    BAM files have no concept of case, they simply encode the base call as a 4 bit integer. While you could do this in a SAM file, it might break a lot of down-stream applications.

    Leave a comment:


  • lindenb
    replied
    even if you could do this, I'm afraid tools like samtools would convert the bases to uppercase.
    here is a test with samtools 1.18, everything is converted to uppercase.

    Code:
    @SQ	SN:ref	LN:45
    @SQ	SN:ref2	LN:40
    r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
    r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
    r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
    r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
    r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
    r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
    x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
    x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
    x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
    x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
    x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
    x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????

    and now piped into a simple samtools view:
    Code:
    ~$ ~/samtools-0.1.18/samtools view -S ~/samtools-0.1.18/examples/toy.sam
    [samopen] SAM header is present: 2 sequences.
    r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
    r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
    r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
    r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
    r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
    r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
    x1	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	????????????????????
    x2	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????
    x3	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????
    x4	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????
    x5	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????
    x6	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????

    Leave a comment:


  • Converting capital to small letter of Exon sequences in SAM/BAM

    I'd appreciate if anybody could let me know any easy ways to convert capital to small letters of exon sequences in a sam/bam files or point to any relevant threads.

    Thanks in advance.

    Aki

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 02:06 PM
0 responses
7 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
27 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
47 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Working...
X