Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • mingkunli
    replied
    Thanks, lh3.

    if I want to use -F to filter out two Flags, or -f to keep two Flags, should I use -F 48, otherwise, I can run -F 4, and -F 8 separately.

    I met the flag 87 with my pair-end data like I show below. I think it maybe due to two possibilities:
    1, software bug.
    2, The match was detected by Smith-Waterman for the unmapped mate.

    No matter which is true, it would cause some problem with other softwares,for example, when i use Tablet to visualize the mapping, the flag will crash the loading.

    SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 87 human_L19 4890 60 76M = 4765 -201 GCCTCCCACCCAAAATGAGTTCCTGCTCTTCCTCCTTGCCCCTCAGCCCTAGTCATTTCCTCATTTGCAGTTCCCC /14414:4494738:<6968>9?<8=;A=>:?>??:=9;96==?;;:<>>=<=<<<>;:A;=>;:=9<98976363 XT:A:U NM:i:2 SM:i:37 AM:i:23 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:10A64T0
    SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 163 human_L19 4765 60 76M = 4890 201 CTGTATTTGCATTTGCTGTCTTGCTGGTCTCAAGATTCCCAAGCGCTGCTGCCAGCCCACCCCTTCAGCCTGCCAA 3186><:;::=:9@?;:<9;:7:96<;=<9>A<;><8:=7;;><:99977:66<95:58847421110/202/02- XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 XA:Z:human_L19,+4765,75M1S,4;human_L19,+4765,76M,5;

    Leave a comment:


  • lh3
    replied
    You should check FLAG 0x2 (see sam spec), not just looking at ISIZE. Anomalous pairs will used by pileup by default. But you can throw them away by:

    samtools view -uf2 aln.bam|samtools pileup -

    Leave a comment:


  • mingkunli
    started a topic PE data processed by bwa

    PE data processed by bwa

    I am processing the PE solexa data using BWA, I met a problem after I looked through the sampe result.

    Although I set the -a(maximum insert size) to be 300, I still found lots of PE mapped with the insertion > 300bp, some even around 5000bp. When I do the pileup, if these PE reads would be taken into consideration ?
    or I should remove these reads manually?

    At the same time, there are also some reads mapped without mate, they are still in the sampe file, will they be taken into account when I do the pileup ?

    All in all, will all the mapped reads(even not in pair or have anomalous insertion distance) in the sampe will be used in the pileup?

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 08:58 AM
0 responses
8 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 02:20 PM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
181 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-06-2024, 08:18 AM
0 responses
230 views
0 likes
Last Post seqadmin  
Working...
X