Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • tophat2 some parameters are not working (--no-novel-indels and -a)

    I used tophat2 to map reads with --no-novel-indels and -a 6 parameters. Once the mapping is done, I examined the result (accepted_hits.bam) and found some lines with indels or some lines whose anchor length < 6.

    ## with insertion
    SRR074943.46688543 369 chr1 10178 0 21M2I27M chr14 69256332 0 CCTAACCCTAACCCTAACCCTAAAACCCTAACCCTAACCCTAACCCTAAC <<;@=ABA=A=BAB7B8B>B?ABA=BBB4B8BBB<B8BBC?B=BBCABBB AS:i:-11 XN:i:0 XM:i:0 XO:i
    :1 XG:i:2 NM:i:2 MD:Z:48 YT:Z:UU NH:i:16 CC:Z:= CP:i:10184 HI:i:0


    ## anchor length < 6
    SRR074943.63823907 329 chr1 14825 0 5M140N45M * 0 0 GATGCCCTTGCGCCTCATGACCAGCTTGTTGAAGAGATCCGATATCAAGT BBBBBBBBBB?A@@B@>BB?:><<?@@?=?<:9@<6:=65:?:7:=:=4, AS:i:-4 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:42C7 YT:Z:UU XS:A:- NH:i:7 CC:Z:c
    hr15 CP:i:102516151 HI:i:0


    There are a lot of lines like these. I am wondering if anyone else had the same problem as this or I did something wrong in running tophat.

    This is the command line I used to run tophat2

    tophat -o tophat_out -N 3 -r 30 --mate-std-dev 110 -a 6 -I 300000 -p 8 -g 20 --no-novel-indels --no-coverage-search hg19_index read_1.fastq read_2.fastq

    Thank you!
    Last edited by statsteam; 05-28-2014, 03:48 PM. Reason: putting a correct example for anchor length <6

  • #2
    I figured out -a 6 parameter issue. It does not ensure individual read to have at least x bps on each side of junction. Instead, it ensures that each junction to have at least one read that meet the anchor condition. If -a 6 is used, each junction must have reads that spans at least 6bps on each side of junction.

    I still do not know why --no-novel-indels does not work.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    31 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    33 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    28 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    53 views
    0 likes
    Last Post seqadmin  
    Working...
    X