Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • BBMerge guide recommends trimming adapters before merging -- but also, in a different place, recommends providing the adapter sequences to BBMerge. Which is best?

    Comment


    • Program ran out of memory on large dataset: Need some tips

      Hi folks,

      We have a shotgun metagenomic dataset (approx. 120Gbs compressed). I want to merge paired-end reads as longer reads will increase assembly performance. And I have tried it on a small subset of data and it remarkably increased N50 and scaffold length.

      But now I want to merged approx 120Gbs of compressed data for subsequent assembly. We have a system with 32 threads and 120Gb of memory. After going through tips on bbtools page, I tried following command and ran out of memory (Error message: This program ran out of memory.
      Try increasing the -Xmx flag and using tool-specific memory-related parameters).

      bbmerge-auto.sh in1=in_R1.fastq.gz in2=in_R2.fastq.gz out=merged.fastq.gz outu1=1_um.fastq.gz outu2=2_um.fastq.gz outa=adapters.txt ihist=insert_histogram.txt k=62 vstrict rem extend2=50 ecct mininsert=150 -Xmx80g minprob=0.8 prefilter=2 prealloc ziplevel=5

      My question are:

      1. Are there any other specific parameters with which it is manageable to run this command on mentioned configured server.

      2. Can I subset the data using partition.sh bbtools wrapper and run the command? But as I understand sub-setting the data will reduced merging of reads. is it true?

      Any tips/advice in this case is appreciated.

      Thanks

      Comment


      • @Shriram369: As long as your reads are in proper order in the files it would be fine to sub-set the data into manageable chunks and then do the merging.

        Comment


        • Can we merge two forward reads with this tool?

          Hi Brain,

          I am really new to bioinformatics data analysis and just found this wonderful tool. Here I have a question: I have several environmental samples (A, B, and C). I sequenced them (shotgun metagenoimcs sequencing; paired-end) and found that, for sample B, the sequencing depth is not high enough. So, I asked the sequencing center to sequence sample B again. In the end, I got two sets of sequencing results for sample B: B.R1, B.R2, B.2nd.R1, and B.2nd.R2. For my downstream analysis (e.g., co-assembly), do you think I should merge B.R1 and B.2nd.R1 first? If so, how can use BBmerge to do that? Based on my understanding, BBmerger is designed to merge R1 and R2. Can it be used to merge two sets of R1s (from two separate sequencing runs)? Or, is that merging even necessary?

          Thanks a lot!

          Yours,

          Comment


          • If you have two separate sequencing runs you can't "merge" the two reads since they are not sequencing the same fragment. Reason you can (in some cases) merge two reads R1/R2 to get a longer representation is because they are sequences from same fragment.

            Comment


            • Hi Brian,

              I'm trying to use your BBMerge program on my trimmed miRNA PE reads, but I am getting a very low merge rate. I looked at the files that had sequences unable to merge to try to understand what the problem could be, but I'm confused because there were sequences that match and could have been merged. (Please refer to the below comparison of the R1 and R2 sequences from the unmergeable files.) Could you provide some insight as to why this might be happening?

              [login001: ~]$ head mirna4Merged/14343_003_R1_fastx_trimmer_NOT_MERGED_output.fastq
              @A00672:72:HNTG5DSX2:4:1101:24198:13369 1:N:0:AAGTACAG
              TTCAAGTAATCCAGGATAGGC
              +
              FFFFFFFFFFFFFFFFFFFFF
              @A00672:72:HNTG5DSX2:4:1101:24795:13369 1:N:0:AAGTACAG
              TGAGGTAGTAGGTTGTGTGGTTT
              +
              FFFFFFFFFFFFFFFFFFFFFFF
              @A00672:72:HNTG5DSX2:4:1101:29351:13369 1:N:0:AAGTACAG
              TATTGCACTCGTCCCGGCCTCC
              [login001: ~]$
              [login001: ~]$
              [login001: ~]$
              [login001: ~]$ head mirna4Merged/14343_003_R2_fastx_trimmer_NOT_MERGED_output.fastq
              @A00672:72:HNTG5DSX2:4:1101:24198:13369 2:N:0:AAGTACAG
              GCCTATCCTGGATTACTTGAA
              +
              FFFFFFFFFFFFFFFFFFFFF
              @A00672:72:HNTG5DSX2:4:1101:24795:13369 2:N:0:AAGTACAG
              AAACCACACAACCTACTACCTCA
              +
              FFFFFFFFFFFFFFFFFFFFFFF
              @A00672:72:HNTG5DSX2:4:1101:29351:13369 2:N:0:AAGTACAG
              GGAGGCCGGGACGAGTGCAATA

              Thank you for your time!
              Emily Shrimpton

              Edit: RESOLVED
              Last edited by Emily Shrimpton; 02-10-2023, 08:40 PM.

              Comment


              • Hi all --

                I'm having trouble with BBMerge, from 38.90...

                Given two fastq reads, adapter trimmed, pre-merge:

                Code:
                r1:
                @M08540:24:000000000-KVP7W:1:1101:14796:2333 1:N:0:AGCGATAG+TAATCTTA
                TACTTTGCGAGATGCCCTAAGCTGGCGGGACTCTGGGGTTCGCGACACTGGCAGAGCATTACGCCCTGCAGGTAATACGACTCACTATAGGGGATAGATGTCCACGAggtctctATCATGCGGCTTTTAACAATCGTACGCTGCAGGTCGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAG
                +
                CCCCCFFFCCCCGGGGGGGGGGHHHGGGGGGHHHHHHGEEHGGGGGGGFHHHHGGHHHHHHHGGGGGHHHHHHHHHHHHFEGGHHHHHHHHHGGGHHHHHHHHHHGGGGGHHHHHHHHHHHGGGGGHHHHHHHHHGHHHGGGGGHHHHHGGGGGGGGGGGGFGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFF
                
                r2:
                @M08540:24:000000000-KVP7W:1:1101:14796:2333 2:N:0:AGCGATAG+TAATCTTA
                GTCGACCTGCAGCGTACGATTGTTAAAAGCCGCATGATAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATGCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGCCAGCTTAGGGCATCTCGCAAAGTAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCTCGGGGGTAGCTGGAGCATTAAAAAAGAAAAAGAGATGAGAGTAGAAG
                +
                BBBB@DBBFFFFGGGGGGCGGGHHHHHHGHHGGGGGHHGHHHHHGHHGHHGGGHHHHHHHHHGHGHHGHHHHHHGGHGHHHGHHHHHHGGGGGGGHHGHHHHHHHHHHHGHGFGGGGGGGHHHHHHGGGGGGHHHHHHHGHHHHHGGGGHGFHHHHHHGGGGHHHGGGGGG.BCFGC:9CCFCFFGGGGFFFGGB0CBFB00;/;.@@D-.;//;.9.9:9//;///-.::/.....9/////::;////
                The relationship between these two reads is (with r2 reverse-complemented, common region in lower case):

                Code:
                r1:                                                                                                         tactttgcgagatgccctaagctggcgggactctggggttcgcgacactggcagagcattacgccctgcaggtaatacgactcactataggggatagatgtccacgaggtctctatcatgcggcttttaacaatcgtacgctgcaggtcgacAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAG
                r2(rc):   CTTCTACTCTCATCTCTTTTTCTTTTTTAATGCTCCAGCTACCCCCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGATCTtactttgcgagatgccctaagctggcgggactctggggttcgcgacactggcagagcattacgccctgcaggtaatacgactcactataggggatagatgtccacgaggtctctatcatgcggcttttaacaatcgtacgctgcaggtcgac
                My desired output is the merged read with all the data included, with no trimming on either end, i.e.:

                Code:
                CTTCTACTCTCATCTCTTTTTCTTTTTTAATGCTCCAGCTACCCCCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGATCTtactttgcgagatgccctaagctggcgggactctggggttcgcgacactggcagagcattacgccctgcaggtaatacgactcactataggggatagatgtccacgaggtctctatcatgcggcttttaacaatcgtacgctgcaggtcgacAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAG
                BBMerge switches used (additional file input and output options are also included):

                qtrim=f qtrim2=f trimq=0 tbo=f tno=f usequality=f forcetrimleft=0 forcetrimright=0 forcetrimright2=0 forcetrimmod=0 forcemerge=t

                produces this merged output:

                Code:
                >M08540:24:000000000-KVP7W:1:1101:14796:2333 1:N:0:AGCGATAG+TAATCTTA
                TACTTTGCGAGATGCCCTAAGCTGGCGGGACTCTGGGGTTCGCGACACTGGCAGAGCATTACGCCCTGCA
                GGTAATACGACTCACTATAGGGGATAGATGTCCACGAGGTCTCTATCATGCGGCTTTTAACAATCGTACG
                CTGCAGGTCGAC
                In other words, it appears to be doing "trimbyoverlap" (tbo) even though it's explicitly set to off.

                Are there setting I can use that will produce the desired output (a 292 bp sequence, with no trimming on either end)?​

                Comment


                • Originally posted by Emily Shrimpton View Post
                  Hi Brian,

                  I'm trying to use your BBMerge program on my trimmed miRNA PE reads, but I am getting a very low merge rate. I looked at the files that had sequences unable to merge to try to understand what the problem could be, but I'm confused because there were sequences that match and could have been merged. (Please refer to the below comparison of the R1 and R2 sequences from the unmergeable files.) Could you provide some insight as to why this might be happening?

                  [login001: ~]$ head mirna4Merged/14343_003_R1_fastx_trimmer_NOT_MERGED_output.fastq
                  @A00672:72:HNTG5DSX2:4:1101:24198:13369 1:N:0:AAGTACAG
                  TTCAAGTAATCCAGGATAGGC
                  +
                  FFFFFFFFFFFFFFFFFFFFF
                  @A00672:72:HNTG5DSX2:4:1101:24795:13369 1:N:0:AAGTACAG
                  TGAGGTAGTAGGTTGTGTGGTTT
                  +
                  FFFFFFFFFFFFFFFFFFFFFFF
                  @A00672:72:HNTG5DSX2:4:1101:29351:13369 1:N:0:AAGTACAG
                  TATTGCACTCGTCCCGGCCTCC
                  [login001: ~]$
                  [login001: ~]$
                  [login001: ~]$
                  [login001: ~]$ head mirna4Merged/14343_003_R2_fastx_trimmer_NOT_MERGED_output.fastq
                  @A00672:72:HNTG5DSX2:4:1101:24198:13369 2:N:0:AAGTACAG
                  GCCTATCCTGGATTACTTGAA
                  +
                  FFFFFFFFFFFFFFFFFFFFF
                  @A00672:72:HNTG5DSX2:4:1101:24795:13369 2:N:0:AAGTACAG
                  AAACCACACAACCTACTACCTCA
                  +
                  FFFFFFFFFFFFFFFFFFFFFFF
                  @A00672:72:HNTG5DSX2:4:1101:29351:13369 2:N:0:AAGTACAG
                  GGAGGCCGGGACGAGTGCAATA

                  Thank you for your time!
                  Emily Shrimpton

                  Edit: RESOLVED
                  Emily Shrimpton - Would you be willing to post how you resolved this (if you still remember)? Thanks!

                  Comment


                  • Hi, I am new to programming and bioinformatics. I am having trouble merging my fastq files with the inclusion of the overhangs/nonoverlapping reads at either end. I tried PEAR before, which gave me final consensus only for the overlapping region. I tried bbmerge and it gave me the same thing. And I am not able to figure out what script I should use to have the final consensus that includes overhangs added to ends of my consensus so I have the full consensus sequences. For example, I have following fastq reads. Could any expert help me with a custom script for this? thanks.

                    @S1_A01_015_F
                    ATTTATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTACGATCCATCAGGCGGAGGAGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG
                    +
                    9>*%**ROOAB*,78K[[[[W>W:0G6J@RP_J__Y_TPK_W_MRP\\__\\__\\\_W;W___\_\W___\__________\___W____\\_W____\___\_________WK__RW____\__\__________RKWWW__RW__W_WRW________________WWWW_\YW___WWWW______WW_WWW_____W_________________\S______LRRW_____Y____________\_W_________________________________\__________________W________________________________WRRWWW___________________________________________________\_____________________________________________RRR_____________________O_____________________________________________________[[[[R[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[WW[[[[[[[[[[[[[[[[[[[[[R[[[[[[W[T[[[[[[[[[[[[R[[[[[[W[[R[[[MQ[[SO[W[LJB[[HMLWRT[[UPRSSSSJ=ISLM[ISIHKSS>@[IDD''&&&&*<A5-*((5

                    @S1_A01_015_R
                    CTCCTCGCCTGATGGATCGTAAAAGATGTATTTAAGTTTCTATCAGTTAATAACATAGTAATTGCACCAGCTAATACAGGTAAAGTTAATAATAATAAAAAAGCAGTAATAAATATAGCCCAAACAAATAAAGGTAATCTATGAAAACTTAAACCTGGAGCTCTCATATTATAAATAGTAGATAAAAAATTAATAGCACCTAATAAAGAAGAAATACCTGATAAATGTAAACTAAAAATAGCTAAATCTACTGAAGGACCTGAATGTGCTTGTACACTTGATAAAGGAGGATATACAGTCCAACCAGTACCTGCACCTGATTCAACAATAGCTGAAGAAACTAATAATAATAATGATGGTGGTAATAACCAAAAACTTATATTATTCATACGAGGAAAAGCCATATCTGGAGCACCAATCATTAAAGGTACAAACCAATTACCAAAACCACCTATTAAAACAGGCATAACCATAAAAAAAATCATAATAAATGCATGTGCTGTAACAACAACATTATATAAATGATGATTCCCAGCAAAAATTTGATTACCGGGTTGTGCTAATTCCATTCTAATTAAAACAGATAATGTAGTTCCTACTACACCAGAAAAAGCACCAAAAATTAAATATAAAGTACCTATGTCTTTATGATTTGTTGAAAA
                    +
                    B*+'2+(0C2W:0[C4'L4(*'*)/=1:?HJ[J<=7____HH_GJI_FS_Y__PP_R___TN_\\T_\M\_\_\\_\OY__\_\_______RR__\_________\__W______\OSYYW_Y___\\\\YCLW_____W_\WW\______\\\\Y_YWYWW___Y\_______W_\SAG<KQY_WRW_____YWQWY\_O\\EYYQN_WC_\Y___\Y_\\__\___\\\_\_\_____Y__\_\__\__YWW_Y_\__\_WQY_Y_Y___\\_\_Y__KYYWLLW_SWWO\___OY\_\Y____\_______\____\__________YYLLWQE_\\___R_____\\\YMYYOOY___________YYYYY\\OOY\\\________N_SRFG__Y\\YYY_YORR_Y__Y__YR___YYYOY__________Y____LYY_OO_Y_____L_Y___YY_________O______________YYLJOYH?=OL___________MU_U___________[NUNMOUURWOQUUUPIIW[OMWOU7?OUUUPWU[[[UUN[WNLW[[WWUWNMU[[U[U[UDLC[QSHRWRSPWQMPQS[VTS[JJPPS[TTTT[[[PQR[[[[[RRJHMRTQQRR[W[R[[LQQSW@MLA9J1QQKL
                    ​​
                    could any expert provide me a custom script for this two fastq files to merge so i get full lenght consensus?

                    I used the command
                    # Construct the BBMerge command with options to not trim the overhangs
                    bbmerge_cmd = f'bbmerge.sh in1={forward_file} in2={reverse_file} out={output_file} outu={output_file}_unmerged.fastq ' \
                    f'qtrim=f qtrim2=f trimq=0 tbo=f tno=f usequality=f forcetrimleft=0 forcetrimright=0 forcetrimright2=0 forcetrimmod=0'​

                    But still it gave me output by trimming the overlapped region as output as below:
                    @S1_A01_015
                    TTTAATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTANGATCCANCAGGCGGAGG

                    But i wanted the consensus as

                    TTTTCAACAAATCATAAAGACATAGGTACTTTATATTTAATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTANGATCCANCAGGCGGAGGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG​​
                    Last edited by ghimbikal; 02-21-2024, 05:54 AM.

                    Comment


                    • I tripped over something to get around the merging problem in bbmerge described above...

                      Merging fastq reads with bbmerge does trim the merge, resulting in only retaining the overlapping part, however -- if I first turn the fastq reads into fasta reads and interleave them, it produces the desired output:

                      Code:
                      Checking output:
                      
                      First two reads from interleaved file:
                      
                      >LH00315.67.22H3LVLT3.1.1101.5558.1048.R1 1:N:0:ACTTCCGG+GACCAATT
                      GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTAAGAGACCTCGTGGACATCTA
                      TCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATG
                      >LH00315.67.22H3LVLT3.1.1101.5558.1048.R2 2:N:0:ACTTCCGG+GACCAATT
                      TCGGACCAACTAAGCTGGCGGGACTCTGGGGTTCGCGACACTGGCAGAGCATTACGCCCTGCAGGTAATA
                      CGACTCACTATAGGGGATAGATGTCCACGAGGTCTCTT
                      
                      
                      >2nd read RC
                      AAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATGCTCTGCCAGTGT
                      CGCGAACCCCAGAGTCCCGCCAGCTTAGTTGGTCCGA
                      
                      Blast alignment:
                      
                      Query  50 AAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATG 108
                                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
                      Sbjct 108 AAGAGACCTCGTGGACATCTATCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATG 50
                      
                      Manual alignment:
                      
                      GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTaagagacctcgtggacatctatcccctatagtgagtcgtattacctgcagggcgtaatg
                                                                       aagagacctcgtggacatctatcccctatagtgagtcgtattacctgcagggcgtaatgCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGCCAGCTTAGTTGGTCCGA
                      
                      Expected sequence (157 bp):
                      GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTaagagacctcgtggacatctatcccctatagtgagtcgtattacctgcagggcgtaatgCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGCCAGCTTAGTTGGTCCGA
                      
                      BBMerge output (157 bp):
                      
                      >LH00315.67.22H3LVLT3.1.1101.5558.1048.R1 1:N:0:ACTTCCGG+GACCAATT
                      GGGACTGTGGCCGTCGACCTGCAGCGTACGGGAATACCTGTTGATATTTAAGAGACCTCGTGGACATCTA
                      TCCCCTATAGTGAGTCGTATTACCTGCAGGGCGTAATGCTCTGCCAGTGTCGCGAACCCCAGAGTCCCGC
                      CAGCTTAGTTGGTCCGA

                      Not sure if combining the R1 and R2 fastq files into a single interleaved file before running bbmerge, or if producing two fasta files rather than one interleaved fasta file will have the same effect.

                      Comment

                      Latest Articles

                      Collapse

                      • seqadmin
                        Best Practices for Single-Cell Sequencing Analysis
                        by seqadmin



                        While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                        06-06-2024, 07:15 AM
                      • seqadmin
                        Latest Developments in Precision Medicine
                        by seqadmin



                        Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                        Somatic Genomics
                        “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                        05-24-2024, 01:16 PM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by seqadmin, Today, 07:23 AM
                      0 responses
                      8 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 06-17-2024, 06:54 AM
                      0 responses
                      12 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 06-14-2024, 07:24 AM
                      0 responses
                      24 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 06-13-2024, 08:58 AM
                      0 responses
                      18 views
                      0 likes
                      Last Post seqadmin  
                      Working...
                      X