Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • BWA: paired end reads, wrong orientation but listed as properly paired

    I have a set of BAM files for a targeted sequencing experiment. After reviewing things in IGV, I noticed that a pair of reads listed as orientation F2R1 are labelled as properly paired. I also noticed another pair listed as F1R2 that were also labelled as properly paired. From my understanding of paired-end sequencing, F1R2 is the correct orientation and F2R1 would be more consistent for mate-pair. The version of BWA used was 0.6.2 and Picard 1.107 for post-processing (conversion to BAM, sorting, indexing, read group addition). I confirmed alignment to the reference genome using BLAT and identified the reads in the original FASTQ files for read 1 and read 2. Any idea why it would list both orientations as properly paired?

    I'm including the SAM entries below with modified read IDS:

    17091 163 chrX 48649459 60 151M = 48649634 326 AAGGATTTCTGTGTCTGAGGACCCCTTCTGTCCTCGCAGGTTAATCCCCAGAGGCTCCAGGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGG @CCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJHHHFFFFFECCEEDBBDDDDDDDDDDDDDDCDDDC@CDDDDDDDDDDDDDED?CBDDDDDCCCDDDDCDDDDDDDDDDDDDB?CADCCCD X0:i:1 X1:i:0 MD:Z:59T91 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 XT:A:U
    49588 99 chrX 48649459 60 151M = 48649532 224 AAGGATTTCTGTGTCTGAGGACCCCTTCTGTCCTCGCAGGTTAATCCCCAGAGGCTCCAGGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGG CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJJHHJJJJJHHHFFFFFFEDEEDDDDDBDDDDDDDDDDDDDDDDCCDDDDDDDDDBDDDEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBDDDDDDD8 X0:i:1 X1:i:0 MD:Z:59T91 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 XT:A:U
    49588 147 chrX 48649532 60 151M = 48649459 -224 CTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGGTTTTCTTCCCCTCTGGGCCTGAGGGCTTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTG DDDDDDDDDDDDDDCCDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBADDDDDDDDDDDDCADEDEDDDDDDDDDDDDDDDDDDDDDDDDFFFFHHHHJJIJJJJJJJJJJJJIJJJJJJJIIJJJJJJJJJJJHHHHHFFFFFCCC X0:i:1 X1:i:0 MD:Z:151 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 XT:A:U
    17091 83 chrX 48649634 60 151M = 48649459 -326 GGCTTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTGCAGCTGCGGCACTGGCCTACTACAGGGACGCTGAGGCCTACAGACACTCCCCAGGTAACTCCATTGAGTGGCTGTCTTGGCATTGGCTGAGTGCTGTTGGGG 8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBDDDDDDDDDDDDDDDDDDDDDDEFEDDDDDDDDDDEFFFFFHHHHHHJIIHHJJIJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC X0:i:1 X1:i:0 MD:Z:151 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 XT:A:U

  • #2
    There's nothing wrong with F2R1 or F1R2. The strand of read 1 is random, and the strand of read 2 should be opposite. What's important is that the forward-mapped read is to the left of the reverse-mapped read (for insert sizes longer than read length), not which read maps forward and which maps reverse.

    Comment


    • #3
      Cross-posted on biostars, where I already answered (note, they should be listed as properly paired).

      Comment


      • #4
        Originally posted by Brian Bushnell View Post
        There's nothing wrong with F2R1 or F1R2. The strand of read 1 is random, and the strand of read 2 should be opposite. What's important is that the forward-mapped read is to the left of the reverse-mapped read (for insert sizes longer than read length), not which read maps forward and which maps reverse.
        Thanks for the info. No clue why I didn't see that in the first place. After confirming the left most and right most reads, the orientation of F2R1 as properly paired clicked in. Thanks again!

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM
        • seqadmin
          Strategies for Sequencing Challenging Samples
          by seqadmin


          Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
          03-22-2024, 06:39 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        33 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        37 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        31 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-04-2024, 09:00 AM
        0 responses
        53 views
        0 likes
        Last Post seqadmin  
        Working...
        X