Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • BWA: paired end reads, wrong orientation but listed as properly paired

    I have a set of BAM files for a targeted sequencing experiment. After reviewing things in IGV, I noticed that a pair of reads listed as orientation F2R1 are labelled as properly paired. I also noticed another pair listed as F1R2 that were also labelled as properly paired. From my understanding of paired-end sequencing, F1R2 is the correct orientation and F2R1 would be more consistent for mate-pair. The version of BWA used was 0.6.2 and Picard 1.107 for post-processing (conversion to BAM, sorting, indexing, read group addition). I confirmed alignment to the reference genome using BLAT and identified the reads in the original FASTQ files for read 1 and read 2. Any idea why it would list both orientations as properly paired?

    I'm including the SAM entries below with modified read IDS:

    17091 163 chrX 48649459 60 151M = 48649634 326 AAGGATTTCTGTGTCTGAGGACCCCTTCTGTCCTCGCAGGTTAATCCCCAGAGGCTCCAGGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGG @CCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJHHHFFFFFECCEEDBBDDDDDDDDDDDDDDCDDDC@CDDDDDDDDDDDDDED?CBDDDDDCCCDDDDCDDDDDDDDDDDDDB?CADCCCD X0:i:1 X1:i:0 MD:Z:59T91 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 XT:A:U
    49588 99 chrX 48649459 60 151M = 48649532 224 AAGGATTTCTGTGTCTGAGGACCCCTTCTGTCCTCGCAGGTTAATCCCCAGAGGCTCCAGGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGG CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJJHHJJJJJHHHFFFFFFEDEEDDDDDBDDDDDDDDDDDDDDDDCCDDDDDDDDDBDDDEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBDDDDDDD8 X0:i:1 X1:i:0 MD:Z:59T91 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 XT:A:U
    49588 147 chrX 48649532 60 151M = 48649459 -224 CTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGGTTTTCTTCCCCTCTGGGCCTGAGGGCTTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTG DDDDDDDDDDDDDDCCDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBADDDDDDDDDDDDCADEDEDDDDDDDDDDDDDDDDDDDDDDDDFFFFHHHHJJIJJJJJJJJJJJJIJJJJJJJIIJJJJJJJJJJJHHHHHFFFFFCCC X0:i:1 X1:i:0 MD:Z:151 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 XT:A:U
    17091 83 chrX 48649634 60 151M = 48649459 -326 GGCTTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTGCAGCTGCGGCACTGGCCTACTACAGGGACGCTGAGGCCTACAGACACTCCCCAGGTAACTCCATTGAGTGGCTGTCTTGGCATTGGCTGAGTGCTGTTGGGG 8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBDDDDDDDDDDDDDDDDDDDDDDEFEDDDDDDDDDDEFFFFFHHHHHHJIIHHJJIJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC X0:i:1 X1:i:0 MD:Z:151 RG:Z:8932118E-CCA7-11E3-9394-35788F63E160 XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 XT:A:U

  • #2
    There's nothing wrong with F2R1 or F1R2. The strand of read 1 is random, and the strand of read 2 should be opposite. What's important is that the forward-mapped read is to the left of the reverse-mapped read (for insert sizes longer than read length), not which read maps forward and which maps reverse.

    Comment


    • #3
      Cross-posted on biostars, where I already answered (note, they should be listed as properly paired).

      Comment


      • #4
        Originally posted by Brian Bushnell View Post
        There's nothing wrong with F2R1 or F1R2. The strand of read 1 is random, and the strand of read 2 should be opposite. What's important is that the forward-mapped read is to the left of the reverse-mapped read (for insert sizes longer than read length), not which read maps forward and which maps reverse.
        Thanks for the info. No clue why I didn't see that in the first place. After confirming the left most and right most reads, the orientation of F2R1 as properly paired clicked in. Thanks again!

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Exploring the Dynamics of the Tumor Microenvironment
          by seqadmin




          The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
          07-08-2024, 03:19 PM
        • seqadmin
          Exploring Human Diversity Through Large-Scale Omics
          by seqadmin


          In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
          06-25-2024, 06:43 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 07-10-2024, 07:30 AM
        0 responses
        29 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-03-2024, 09:45 AM
        0 responses
        201 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-03-2024, 08:54 AM
        0 responses
        212 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-02-2024, 03:00 PM
        0 responses
        193 views
        0 likes
        Last Post seqadmin  
        Working...
        X