Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bowtie2 output with paired end reads

    Hi,

    I am trying to use bowtie2 to align paired end Illumina read files.

    I am using following command:

    ./bowtie2 -a --threads 8 --n-ceil 42 --very-sensitive-local --quiet --no-sq --no-hd --np 0 --ma 1 --mp 0,0 --rdg 1,1 --rfg 1,1 --score-min L,0,0.95 -x rdp/bt2_index/rdp.db -q -1 sR1.fastq -2 sR2.fastq > bt2out.txt

    The index is made from RDP II database and currently sR1.fastq and sR2.fastq contain only one read:

    sR1.fastq:
    @1_M01363:14:000000000-A5K8J:1:1101:8617:1211 1:N:0:16
    TACGGAGGATCCGAGCGTTATCCGGA...

    sR2.fastq:
    @2_M01363:14:000000000-A5K8J:1:1101:8617:1211 2:N:0:16
    TTCACCGTTGCCGGCGTACTCCCCAGGTGGA

    The bt2out.txt file shows mostly results with sR1.fastq read header.

    1_M01363:14:000000000-A5K8J:1:1101:8617:1211....
    1_M01363:14:000000000-A5K8J:1:1101:8617:1211....
    1_M01363:14:000000000-A5K8J:1:1101:8617:1211....
    .
    .
    .

    I am not sure how to read bowtie2 results. How can I obtain information how each matching read aligned as a pair?

    Thanks

  • #2
    Bowtie2 should be outputting BAM/SAM files. Read up on that format. If you have further questions after reading about SAM files -- especially the bitwise flag field -- then ask a question.

    Comment


    • #3
      It appears that sampie omitted "-S filename_to_hold_alignments.sam" option on the command line to write the alignments to a file.

      Comment


      • #4
        Originally posted by GenoMax View Post
        It appears that sampie omitted "-S filename_to_hold_alignments.sam" option on the command line to write the alignments to a file.
        While good practice the '-S' is optional. As per the docs:


        -S <hit>
        File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console).
        So the stdout file of bt2out.txt should be a SAM file.

        Comment


        • #5
          As long as we're talking best practices, I would definitely pipe the output through samtools and save a BAM rather than a SAM file. There's no reason a SAM file should ever exist on a hard drive.

          Comment


          • #6
            Thanks for replies.

            I took a look at SAM format specification. It was more clear to me than bowtie2 manual.

            I am now testing bits 0x1, 0x2 and 0x8 from flags and if they are on I am determining that current match is R2 and previous match is R1 (of the same pair).

            Hopefully it works correctly now.

            Comment

            Latest Articles

            Collapse

            • seqadmin
              The Impact of AI in Genomic Medicine
              by seqadmin



              Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
              02-26-2024, 02:07 PM
            • seqadmin
              Multiomics Techniques Advancing Disease Research
              by seqadmin


              New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

              A major leap in the field has
              ...
              02-08-2024, 06:33 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, 02-28-2024, 06:12 AM
            0 responses
            25 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-23-2024, 04:11 PM
            0 responses
            72 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-21-2024, 08:52 AM
            0 responses
            80 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 02-20-2024, 08:57 AM
            0 responses
            69 views
            0 likes
            Last Post seqadmin  
            Working...
            X