Thanks, I will look there to find proper index. This is the example for the current index from flybase, I guess with this, I cannot get what I want no matter what...
but if I don't need the transcript data, I can convert the gene information with a map table to chromosome localization.
>FBtr0071764 type=mRNA; loc=2R:join(22137433..22138251,22151654..22151695,22162905..22163694,22164777..22164989,22169244..22170717,22170778..22171985,22172082..22172252,22172316..22172433,22172497..22172834); ID=FBtr0071764; name=a-RB; dbxref=FlyBase_Annotation_IDs:CG6741-RB,FlyBase:FBtr0071764,REFSEQ:NM_079902,REFSEQ:NM_079902; score=7; score_text=Moderately Supported; MD5=b3804d1c3dd8c6afd72ec955dc6c8c3b; length=5173; parent=FBgn0000008; release=r6.03; species=Dmel;
CGAATACACAAATCAAAGCAAGTGTCTGTGTGATTGTAAAGAAGAATGTGCTAAGCAAATAAGGCAAATAACAACCATA
TAACTGTAACTGAAATCCCACACTGAGAAAATAATCAGCGAAGAATAATATTTTGACATCCGTCTCTTGAAATATAAGA
TCAAACTTTAGGTTAATACTCATTAGAAATATATCAATAAGCTATGAAATATCATTTAAATAAAAATGTAGTGATCTTA
TTTTCATTTTTCTTCGTGCTCTCATAAGACAAGTTGATTGATTTGCGCAAAGGGAATTCGAGACACTTAAGATATTACC
-
I am afraid you are going to have to re-do the alignments if you want to visualize the data for chromosomal locations. I would suggest that you download the indexes/annotations from iGenomes site: http://support.illumina.com/sequenci...e/igenome.html for UCSC build.Leave a comment:
-
Right now I already have the mapped data. But if there is an option to use chromosome localization, I can do it again by myself.
Here is an example:
HWI-ST484:183:C167BACXX:7:1103:13372:100580 0 FBgn0035951 49 255 49M * 0 0 GTTGAATTGGAACTATTTTTTTGTTTTCGAAAACGGATAATTGCGAGCA aabeeeeeggfggiiiiiiiiiihiiiihihhiiiiiiiihiihiiiig XA:i:0 MD:Z:49 NM:i:0
Thanks~Leave a comment:
-
Is there a specific reason you want to visualize the data at UCSC? You could also use a local genome viewer like IGV from Broad.
Did you create the transcriptome indexes yourself or did you download them from somewhere? Can you post a few lines from your SAM file (the chromosome locations may already be there, skip reference sequence headers if they are included)?Leave a comment:
-
RNA-seq alignment for fly with bowtie
HI Everyone,
When I did alignment for my cDNA sample to fly genome with bowtie, the id for each read was set to FBgn#. But if I want to view the result with UCSC genome browser, I think the ID need to be chromosome location. Is there options in bowtie that when we do the alignment, we can set the ID to chromosome location?
Thanks a lot in advance for help.
-
The COVID-19 pandemic highlighted the need for proactive pathogen surveillance systems. As ongoing threats like avian influenza and newly emerging infections continue to pose risks, researchers are working to improve how quickly and accurately pathogens can be identified and tracked. In a recent SEQanswers webinar, two experts discussed how next-generation sequencing (NGS) and machine learning are shaping efforts to monitor viral variation and trace the origins of infectious...Today, 11:48 AM -
This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.
The Headliner
The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...03-03-2025, 01:39 PM -
The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...02-24-2025, 06:31 AM
Leave a comment: