RNA-seq alignment for fly with bowtie

[Karli_40]

HI Everyone,

When I did alignment for my cDNA sample to fly genome with bowtie, the id for each read was set to FBgn#. But if I want to view the result with UCSC genome browser, I think the ID need to be chromosome location. Is there options in bowtie that when we do the alignment, we can set the ID to chromosome location?

Thanks a lot in advance for help.

[GenoMax]

Is there a specific reason you want to visualize the data at UCSC? You could also use a local genome viewer like IGV from Broad.

Did you create the transcriptome indexes yourself or did you download them from somewhere? Can you post a few lines from your SAM file (the chromosome locations may already be there, skip reference sequence headers if they are included)?

[Karli_40]

Right now I already have the mapped data. But if there is an option to use chromosome localization, I can do it again by myself.
Here is an example:
HWI-ST484:183:C167BACXX:7:1103:13372:100580 0 FBgn0035951 49 255 49M * 0 0 GTTGAATTGGAACTATTTTTTTGTTTTCGAAAACGGATAATTGCGAGCA aabeeeeeggfggiiiiiiiiiihiiiihihhiiiiiiiihiihiiiig XA:i:0 MD:Z:49 NM:i:0
Thanks~

[GenoMax]

I am afraid you are going to have to re-do the alignments if you want to visualize the data for chromosomal locations. I would suggest that you download the indexes/annotations from iGenomes site: http://support.illumina.com/sequenci...e/igenome.html for UCSC build.

[Karli_40]

Thanks, I will look there to find proper index. This is the example for the current index from flybase, I guess with this, I cannot get what I want no matter what...
but if I don't need the transcript data, I can convert the gene information with a map table to chromosome localization.

>FBtr0071764 type=mRNA; loc=2R:join(22137433..22138251,22151654..22151695,22162905..22163694,22164777..22164989,22169244..22170717,22170778..22171985,22172082..22172252,22172316..22172433,22172497..22172834); ID=FBtr0071764; name=a-RB; dbxref=FlyBase_Annotation_IDs:CG6741-RB,FlyBase:FBtr0071764,REFSEQ:NM_079902,REFSEQ:NM_079902; score=7; score_text=Moderately Supported; MD5=b3804d1c3dd8c6afd72ec955dc6c8c3b; length=5173; parent=FBgn0000008; release=r6.03; species=Dmel;
CGAATACACAAATCAAAGCAAGTGTCTGTGTGATTGTAAAGAAGAATGTGCTAAGCAAATAAGGCAAATAACAACCATA
TAACTGTAACTGAAATCCCACACTGAGAAAATAATCAGCGAAGAATAATATTTTGACATCCGTCTCTTGAAATATAAGA
TCAAACTTTAGGTTAATACTCATTAGAAATATATCAATAAGCTATGAAATATCATTTAAATAAAAATGTAGTGATCTTA
TTTTCATTTTTCTTCGTGCTCTCATAAGACAAGTTGATTGATTTGCGCAAAGGGAATTCGAGACACTTAAGATATTACC