Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • capricy
    replied
    Ok, I will go with this idea!

    Thanks

    Leave a comment:


  • cascoamarillo
    replied
    Why would you want to do that? Probably you have your reasons. One idea: I think using htseq-count (you need sam file as input) have the option of giving another sam output (--samout) which have some extra gene alignment information on it (along the flags). Then you can parse this sam output with your desire info. Good luck.

    Leave a comment:


  • capricy
    replied
    I am looking for which gene was mapped by the reads. For example:

    My alignment file:
    ----
    HWI-M01439:125:000000000-A7P33:1:1110:21257:22290 99 A_Cont998 55849 50 106M95N138M98N6M = 55887 481 ATTTTGAAGATATCGGAGTATTAGACCTCGACGCCTCACGTGAGCCAATGAGGGCTTTAGTTTGACTTCGTGTGACCTTCACCGCAGGATCAGTTGTGGAGAGGAACAGTTCCGTCACTGTGTTCTTATGCGTAGGATCAAATAACTTTTTCAATTCGCCAGATGCAGCAGCCACTTCAGCGGCCGTCTGCCCATAAAAGACGTCATCCTCCTGCAGTTCCCGAGGTTTAAGGCCAGTTTTATCATCTCT CDCEEFDFFFFFGGGGGGGGGGHHHHHHHGGGGGGHGHHHHHHGHHHHHHHHHGGHHHHHHHHHHHHHHGHGHHHHHHHHHHHGGGGGGHHHHHHHHGGHHHGGHHHHHHHHHGHHGGHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHHGGGGGGGHGHGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFHHFFFHFFHFHF MD:Z:250 XG:i:0 NH:i:1 NM:i:0 XM:i:0 XO:i:0 AS:i:0 XS:A:-
    HWI-M01439:125:000000000-A7P33:1:1110:21257:22290 147 A_Cont998 55887 50 68M95N138M98N44M = 55849 -481 CGTGAGCCAATGAGGGCTTTAGTTTGACTTCGTGTGACCTTCACCGCAGGATCAGTTGTGGAGAGGAACAGTTCCGTCACTGTGTTCTTATGCGTAGGATCAAATAACTTTTTCAATTCGCCAGATGCAGCAGCCACTTCAGCGGCCGTCTGCCCATAAAAGACGTCATCCTCCTGCAGTTCCCGAGGTTTAAGGCCAGTTTTATCATCTCTAGTAACTATTTCCGAAACGTACTCCCAACGTGGGCCTC EFBFFFFFFFFFFFFFFFFFFFFFFFEFFFFFFFFBBGFBA9.FAGFGGGGFFGGGGFBFFFGGGHHGHHEEECGGGHHHHHHHHHHFGGGGGHHHHHHHHHHHHHGGHHHGGHHGC<CHHFHHHGHHHGGHGHHGHHGGGGGGGGGHGGHHHHHHHHHGHGGGHHHHFGGGHHHHHHGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGHHHGGGGGGGGGGFCCDDDDDDDDD MD:Z:250 XG:i:0 NH:i:1 NM:i:0 XM:i:0 XO:i:0 AS:i:0 XS:A:-
    ----

    my gff file indicate that: B gene is located on scaffold A_Cont998, between 558000 - 578000

    I would like to have an output: HWI-M01439:125:000000000-A7P33:1:1110:21257:22290 "B gene"

    I don't need to count, just match reads to genes, based on bam file and gff file

    Any idea? Thanks a lot!

    Leave a comment:


  • GenoMax
    replied
    Are you looking for coverage information (http://bedtools.readthedocs.org/en/l.../coverage.html) or actually looking to extract reads that are mapped to the genes (http://seqanswers.com/forums/showthread.php?t=50390)?

    Leave a comment:


  • how to extract information about mapped genes from a genome-mapping bam file

    Hello, there,

    I mapped the reads to the genome scaffold using tophat and got a bam file. I have gff file for the genome sequences. I wonder if there is an easy way to extract the information about the mapped genes and the corresponding reads.

    Thank you for your help.

    Capricy

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 07:20 AM
0 responses
24 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-16-2024, 05:49 AM
0 responses
38 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-15-2024, 06:53 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
41 views
0 likes
Last Post seqadmin  
Working...
X