Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • About Mosaik Assembler Consensus String

    Hello everybody,

    I just want to know how I can get a consensus string from the output of mosaik .ace file.

    If that's impossible, is there any other way to get the consensus string?

    Thanks

  • #2
    Unless I am mistaken or misunderstand your question, the ace file begins with the consensus, or rather, each contig entry in the ace file begins with the consensus, for example:

    Code:
    AS    8364 763600  
    
    CO contig00001 152567 9338 3216 U
    AgTTTTTg*TCAa*gCCGAAACCCGTAA*TCACAAAGGCTTTTTtGTGAA
    ACAAGgAGCCTATAaGTTAAAAAaTA*TTGATGAATCGGGTTGGGCTTTA
    ATCTGTG*TTGATG*A*CACCGTTTGTTATTACGTTGATCCCGATAATTT
    .... etc
    Just remove the '*' symbols (gaps introduced for optimizing alignemtn) and you're there.

    Comment


    • #3
      Thanks, maybe I have interpreted consensus wrong, but what I want is, if at certain bp the reads are different from the reference, I want the reads bp, instead of the reference.

      I ran a simple test assembly using Mosaik 1.0.1388, and the ace file looks like:

      Code:
      AS 1 3
      
      CO test 50 3 1 U
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      
      BQ ......
      
      AF .MosaikReference U 1
      AF read2 U 1
      AF read1 U 2
      BS 1 50 .MosaikReference
      
      RD .MosaikReference 50 0 0
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      
      RD read2 49 0 0
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTT
      
      RD read1 49 0 0
      ATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      In this run, the consensus is identical to the reference at the red bp, i.e. T, but I wanted it to be G, like in the reads.
      Last edited by Iris Cristata; 07-04-2010, 07:00 PM.

      Comment


      • #4
        There is no simple way to get the consensus from an ACE file, simply because it's not in there.
        The CO tags represent the COntig sequences, what is usually the reference sequence in
        mapping approaches.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          The Impact of AI in Genomic Medicine
          by seqadmin



          Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
          02-26-2024, 02:07 PM
        • seqadmin
          Multiomics Techniques Advancing Disease Research
          by seqadmin


          New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

          A major leap in the field has
          ...
          02-08-2024, 06:33 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 02-28-2024, 06:12 AM
        0 responses
        24 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-23-2024, 04:11 PM
        0 responses
        71 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-21-2024, 08:52 AM
        0 responses
        79 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 02-20-2024, 08:57 AM
        0 responses
        69 views
        0 likes
        Last Post seqadmin  
        Working...
        X