Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • sklages
    replied
    There is no simple way to get the consensus from an ACE file, simply because it's not in there.
    The CO tags represent the COntig sequences, what is usually the reference sequence in
    mapping approaches.

    Leave a comment:


  • Iris Cristata
    replied
    Thanks, maybe I have interpreted consensus wrong, but what I want is, if at certain bp the reads are different from the reference, I want the reads bp, instead of the reference.

    I ran a simple test assembly using Mosaik 1.0.1388, and the ace file looks like:

    Code:
    AS 1 3
    
    CO test 50 3 1 U
    AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
    
    BQ ......
    
    AF .MosaikReference U 1
    AF read2 U 1
    AF read1 U 2
    BS 1 50 .MosaikReference
    
    RD .MosaikReference 50 0 0
    AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
    
    RD read2 49 0 0
    AATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTT
    
    RD read1 49 0 0
    ATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
    In this run, the consensus is identical to the reference at the red bp, i.e. T, but I wanted it to be G, like in the reads.
    Last edited by Iris Cristata; 07-04-2010, 07:00 PM.

    Leave a comment:


  • flxlex
    replied
    Unless I am mistaken or misunderstand your question, the ace file begins with the consensus, or rather, each contig entry in the ace file begins with the consensus, for example:

    Code:
    AS    8364 763600  
    
    CO contig00001 152567 9338 3216 U
    AgTTTTTg*TCAa*gCCGAAACCCGTAA*TCACAAAGGCTTTTTtGTGAA
    ACAAGgAGCCTATAaGTTAAAAAaTA*TTGATGAATCGGGTTGGGCTTTA
    ATCTGTG*TTGATG*A*CACCGTTTGTTATTACGTTGATCCCGATAATTT
    .... etc
    Just remove the '*' symbols (gaps introduced for optimizing alignemtn) and you're there.

    Leave a comment:


  • Iris Cristata
    started a topic About Mosaik Assembler Consensus String

    About Mosaik Assembler Consensus String

    Hello everybody,

    I just want to know how I can get a consensus string from the output of mosaik .ace file.

    If that's impossible, is there any other way to get the consensus string?

    Thanks

Latest Articles

Collapse

  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-23-2024, 04:11 PM
1 response
22 views
0 likes
Last Post kim897
by kim897
 
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
40 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
27 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
59 views
0 likes
Last Post seqadmin  
Working...
X