Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Questions on Cuffdiff with mapping to transcriptome

    Hi Everyone,

    I have some questions on if my results are valid by using cuffdiff.
    What I did currently is that I did alignment with bowtie to drosophila transcript-r5.55. Unlike common references, this reference is in the format of following:
    >FBtr0086024 type=mRNA; loc=2R:complement(1944862..1947063); ID=FBtr0086024; name=CG7856-RA; dbxref=FlyBase:FBtr0086024,FlyBase_Annotation_IDs:CG7856-RA,REFSEQ:NM_136354; score=11; score_text=Strongly Supported; MD5=7ca9c4371b97aaf7046cf83fefb65eb8; length=2202; parent=FBgn0033056; release=r5.55; species=Dmel;
    GGTAAAGTTGCCTTGGCGTCAGTTGGCAGTTTGGGAAAAGCCTACACACT
    TAATATTTCGATAGATACACTTATTTCGCAATCGTAGAAGATACCACAAA
    TCTCTCTTCCGTAAATTATAAGTATGTCCAAGAGGGTGAGCATCATGTTG
    CCCGACGAAATACCTGCGGCTCCGTCAGGCAGCAGGAGGAACCCGATGCC......
    So when I got the bam file, the column usually indicating chromosome localization is already filled with FBtr#:XXX-XXX (instead of chr1:XXX-XXX) which could be used as annotation.
    I run the bam file in cufflinks to get the GTF file for each file and run cuffmerge to get a merged GTF file for files in the same set of experiment. Then I run cuffdiff with merged GTF file and bam files. I did NOT use any reference GTF files during those steps since the reference for mapping I used is already annotated as I described above. In cuffdiff output file isoform_exp.diff under the column of loci, the value also remained FBtr#:XXX-XXX. It means for each transcript, it is compared in different region. So should I consider if any of the region is differentially expressed, the transcript is differentially expressed? And is this going to affect validity of cuffdiff's calculation since this equals to do assembly first then quantification for differential expression compared to usually it does quantification first then assembly?

    Thanks in advance.

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    Today, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 07:15 AM
0 responses
10 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 10:28 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 07:35 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
8 views
0 likes
Last Post seqadmin  
Working...
X