Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • extracting complete sequence for every transcript from a bam file

    hi,

    I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like
    Code:
    >ref_tr1
    aggtcgtttagtcgatatcgtga
    >aln_tr1
    a-gtcgtttagtcgat-tcgtga
    I would like to obtain a fasta file containing only aligned trasncripts like
    Code:
    >aln_tr1
    a-gtcgtttagtcgat-tcgtga
    >aln_tr2
    agtgtcgggctgag--gcg-cc
    How can I obtain this fast file from aligned bam file. Kindly guide me.
    Thanks in advance
    Last edited by dena.dinesh; 08-04-2015, 02:27 AM.

  • #2
    Of course it's possible. You can use "bedtools."

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin


      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      ...
      02-08-2024, 06:33 AM
    • seqadmin
      The 3D Genome: New Technologies and Emerging Insights
      by seqadmin


      The study of three-dimensional (3D) genomics explores the spatial structure of genomes and their role in processes like gene expression and DNA replication. By employing innovative technologies, researchers can study these arrangements to discover their role in various biological processes. Scientists continue to find new ways in which the organization of DNA is involved in processes like development1 and disease2.

      Basic Organization and Structure
      Understanding...
      01-22-2024, 03:25 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Today, 08:52 AM
    0 responses
    10 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, Yesterday, 08:57 AM
    0 responses
    12 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-14-2024, 09:19 AM
    0 responses
    48 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-12-2024, 03:37 PM
    0 responses
    422 views
    0 likes
    Last Post seqadmin  
    Working...
    X