Header Leaderboard Ad

Collapse

Create perl program

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • cmccabe
    replied
    @vineetha: Can awk be used to do this? A one-liner like below will work.

    Code:
    awk 'NR==FNR{a[$0];next}$0 in a{print $0}' file1.txt file2.txt
    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC
    
    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG
    
    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG
    The perl equivalent would be something like:

    Code:
    perl -ne 'print if ($seen{$_} .= @ARGV) =~ /10$/'  file1.txt file2.txt
    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC
    
    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG
    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG
    Last edited by cmccabe; 10-01-2015, 12:59 PM. Reason: added perl

    Leave a comment:


  • GenoMax
    replied
    @vineetha: Are you looking to actually match the sequences or you just want to find matching headers? If a header matches then is the sequence always identical in both files?

    Leave a comment:


  • lindenb
    replied
    cross-posted : https://www.biostars.org/p/160027/

    Leave a comment:


  • vineetha
    started a topic Create perl program

    Create perl program

    Hi,

    I have two sequence file.I want only the mathching sequences which is present on both files and save that output in third file...Can you please help me for creating perl program for this.??

    FILE1:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig2
    GACTTGAAGATGCTGGTCTTTCTTTCACTGGCAAAGATGAAAGTGGTCATCGCATGGAGATTGTTGAGCTGCCGAGTCATCCTTACTTCATCGGAGTTCAATTTCATCCAGAATTTAAATCAAGGCCAGGAACCCCTTCAGCCCTGTTT

    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    >Contig5
    CCCCCCCTTATTTGTCGTTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    FILE2:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig3

    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    >Contig6
    GCATTTATTGCAATGTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAGCCAGAGCTTTGTAGATGAGAGGCATGGTACAATGCGTCTTG

    EXPECTED OUTPUT:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

Latest Articles

Collapse

  • seqadmin
    A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
    by seqadmin


    ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

    01-24-2023, 01:19 PM
  • seqadmin
    Introduction to Single-Cell Sequencing
    by seqadmin
    Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

    The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
    ...
    01-09-2023, 03:10 PM

ad_right_rmr

Collapse
Working...
X