Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • cutadapt questions on pair-end seqeuencing data

    I'm trying to use cutadapt to trim my data. The adaptor sequences from Illumina only has a universal adapter, then one sequence for each index.
    Example here:
    TruSeq Universal Adapter
    5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    TruSeq Adapter, Index 1 5
    5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
    TruSeq Adapter, Index 2
    5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
    TruSeq Adapter, Index 3
    5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG

    When I read the guide from cutadapt for pair-end data, they suggest a file named ADAPTER_FWD (should be trimmed from the forward reads (filename.1.fastq.gz) and a file named ADAPTER_REV from the reverse reads (filename.2.fastq.gz).
    So my question is: What sequence do I put in ADAPTER_FWD, and what sequence in ADAPTER_REV?


    The command is:
    cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq

  • #2
    Another related question here:
    My sequencing center said they didn't trimmed any adapters. So I went to the fastq.gz files, and grep the adapter sequence for the first 1 million reads, I only have 10442 hits. I wonder why the hits number is so small? Does that mean 989,558 reads are shorter and without the adapters?
    Thanks!

    Comment


    • #3
      Most sequences will be shorter than full length, and/or contain errors, and thus not match exactly with grep.

      I recommend you use BBDuk for adapter trimming, using the command at the top of the post.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Latest Developments in Precision Medicine
        by seqadmin



        Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

        Somatic Genomics
        “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
        Today, 01:16 PM
      • seqadmin
        Recent Advances in Sequencing Analysis Tools
        by seqadmin


        The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
        05-06-2024, 07:48 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Today, 07:15 AM
      0 responses
      10 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, Yesterday, 10:28 AM
      0 responses
      15 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, Yesterday, 07:35 AM
      0 responses
      16 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-22-2024, 02:06 PM
      0 responses
      8 views
      0 likes
      Last Post seqadmin  
      Working...
      X