Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 mapping quality explanation

    Hello, there,

    I am curious how the mapping score is calculated by bowtie and wonder what is the general cutoff to keep a valid read from bowtie output.

    The bowtie manual says that mapping quality <10 might suggest the multiple alignments.

    What I've noticed is that some low complexity reads give pretty low mapping quality scores. But they are not mapped to multiple sites at all.

    For examples, both of the following sequences have mapping quality of 6, even though one contains almost a polyG sequence:

    NS500253:4:H14JDBGXX:1:22111:1653:3874 147 NC_010451.3 5426974 6 144M = 5426886 -232 GCGGGAGAAGTCCCGGCAGAATTGAAGCTGCTTCTTTGAATTTGCAATTCAACATGACATTCACCACGGAACTGGCAAAAAGAGGGCTTAACCTCTGTCTTTAGATTTACAGTCTAATGCTTACTCAGCCATTTTACCTATGTT F<F.<<FF7FFAFF)F<FF7FA7AFFAFFAFAFFFF7FFFF<<FFFFF<FAFFFAFFAF7FFFF<FF.FFFFFF7FFFAFFFFF)F.AFFFFFFFFFFFFFFFFFFF.FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFAAAAAA AS:i:0 XS:i:-5 XN:i:0 XM:i:0 XO:i:0XG:i:0 NM:i:0 MD:Z:144 YS:i:0 YT:Z:CP
    NS500253:4:H14JDBGXX:1:22111:4914:4835 73 NC_010459.4 37759824 6 151M = 37759824 0 ATTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG <AAAAF.AFFFFFFFFFFAFFFFFFFFAFAFFFFAFFFFFFFAFFAFAAFAFFAFFFF7FFAFFFFAFFFFFFFAAFFAAFFFFA7FAFFFAF7AF.FA<FFF..F.AAFFFAFFFFFFAFFF7FFAFF7FAF<<.FAFA.FFFF<F<A.F AS:i:-5 XS:i:-6 XN:i:5 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:0N0N0N0N0N146 YT:Z:UP

    Thanks for any input

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
11 views
0 likes
Last Post seqadmin  
Working...
X