Maq problems getting started

[alig]

I have downloaded Maq & am trying to get the program to work.
When I try to run Maq I get this output

maq.pl demo ref.fasta calib-36.dat
-- CMD: mkdir -p maqdemo
-- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
calib-30.dat > maqdemo/true.snp
> > /usr/bin/maq: line 1: .": command not found
> > /usr/bin/maq: line 2: .": command not found
> > /usr/bin/maq: line 3: .": command not found
> > /usr/bin/maq: line 4: .": command not found
> > /usr/bin/maq: line 5: .de: command not found
> > /usr/bin/maq: line 6: .br: command not found
> > /usr/bin/maq: line 7: .if: command not found
> > /usr/bin/maq: line 8: .ne: command not found
> > /usr/bin/maq: line 9: .PP: command not found
> > /usr/bin/maq: line 10: fB\simulatefR: command not found
> > /usr/bin/maq: line 11: .PP: command not found
> > /usr/bin/maq: line 12: ..: command not found
> > /usr/bin/maq: line 13: syntax error near unexpected token `('
> > /usr/bin/maq: line 13: `.de Sp \" Vertical space (when we can't use .PP)'
> > ** fail to run command '/usr/bin/maq simulate -N 1000000 maqdemo/r1.fq
> > maqdemo/r2.fq ref.fasta calib-30.dat > maqdemo/true.snp' at /usr/bin/
> > maq.pl line 842.


If I try to run maq.pl easyrun -d outdir ref.fasta reads.fastq command I get

-- CMD: /usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null
** fail to run command '/usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null' at /usr/bin/maq.pl line 842.

I save my ref.fasta file in Bbedit as Unix format. I'm not a bioinformatician
so am struggling.

any help would be greatly appreciated

alig

[ECO]

Hey Alig,

here is the output from that command when it's running correctly:

[SIZE=1]eco@******:~/perl/maq$ maq.pl demo testref.fa calib-36.dat 
-- CMD: mkdir -p maqdemo
-- CMD: /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq testref.fa calib-36.dat > maqdemo/true.snp
-- 1 sequences, total length: 312
-- CMD: /usr/local/bin/maq fasta2bfa testref.fa maqdemo/ref.bfa
-- 1 sequences have been converted.
-- CMD: (cd maqdemo; /usr/local/bin/maq.pl easyrun -p -d easyrun ref.bfa r1.fq r2.fq)
-- CMD: ln -sf /Users/eco/perl/maq/maqdemo/ref.bfa easyrun/ref.bfa
-- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /Users/eco/perl/maq/maqdemo/r1.fq easyrun/read1
-- finish writing file 'easyrun/[email protected]'
-- 1000000 sequences were loaded.
-- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /Users/eco/perl/maq/maqdemo/r2.fq easyrun/read2
-- finish writing file 'easyrun/[email protected]'
-- 1000000 sequences were loaded.
-- CMD: (cd easyrun; /usr/local/bin/maq map  -n 2 -e 70 [email protected] ref.bfa [email protected] [email protected] 2> [email protected])
-- CMD: (cd easyrun; mv [email protected] all.map)
-- CMD: (cd easyrun; /usr/local/bin/maq mapcheck ref.bfa all.map > mapcheck.txt)
[ma_mapcheck] processing refernces...
-- CMD: (cd easyrun; /usr/local/bin/maq assemble -N 2 -Q 60 consensus.cns ref.bfa all.map 2> assemble.log)
-- CMD: /usr/local/bin/maq cns2fq easyrun/consensus.cns > easyrun/cns.fq
-- CMD: /usr/local/bin/maq cns2snp easyrun/consensus.cns > easyrun/cns.snp
-- CMD: /usr/local/bin/maq cns2win easyrun/consensus.cns > easyrun/cns.win
-- CMD: /usr/local/bin/maq indelsoa easyrun/ref.bfa easyrun/all.map > easyrun/cns.indelse
-- CMD: /usr/local/bin/maq indelpe easyrun/ref.bfa easyrun/all.map > easyrun/cns.indelpe
-- CMD: /usr/local/bin/maq.pl SNPfilter -q 40 -w 5 -N 2 -f easyrun/cns.indelse -F easyrun/cns.indelpe -d 3 -D 256 -n 20 -Q60 easyrun/cns.snp > easyrun/cns.final.snp
-- 0 potential soa-indels pass the filter.
-- 0 potential pe-indels pass the filter.
-- CMD: (cd easyrun; ln -s cns.final.snp cns.filter.snp)
-- CMD: /usr/local/bin/maq.pl statmap easyrun/*.map.log

-- == statmap report ==

-- # single end (SE) reads: 0
-- # mapped SE reads: 0 (/ 0 = NA%)
-- # paired end (PE) reads: 2000000
-- # mapped PE reads: 2000000 (/ 2000000 = 100%)
-- # reads that are mapped in pairs: 1999942 (/ 2000000 = 99.99%)
-- # Q>=30 reads that are moved to meet mate-pair requirement: 0 (/ 1999942 = 0%)
-- # Q<30 reads that are moved to meet mate-pair requirement: 0 (0%)

-- CMD: (cd maqdemo; /usr/local/bin/maq simustat easyrun/all.map > eval.simustat)
-- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl sub -p eval.sub true.snp true.snp easyrun/cns.filter.snp)
-- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl indelpe true.snp easyrun/cns.indelpe > eval.indelpe)
-- CMD: (cd maqdemo; /usr/local/bin/maq_eval.pl indelsoa true.snp easyrun/cns.indelse > eval.indelse)
++ maqdemo/easyrun/cns.filter.snp gives the SNPs that passes most of filters.
++ maqdemo/easyrun/cns.final.snp is the high-quality subset of the previous SNPs.
++ maqdemo/easyrun/mapcheck.txt gives some statistics about qualities.
++ maqdemo/true.snp contains all variants used in simulation.
++ maqdemo/eval.* give various benchmarks. Their formats will be documented later.[/SIZE]

First, I assume you did indeed download maq-data (the calib-36.dat file), here is the output when that file isn't there.

[SIZE=1]-- CMD: mkdir -p maqdemo
-- CMD: /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp
[maq_simulate] cannot open parameter file 'calib-36.dat'
Assertion failed: (fpout1 && fpout2 && fp_fa && fp_par), function maq_simulate, file simulate.c, line 365.
sh: line 1:  5836 Abort trap              /usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp
** fail to run command '/usr/local/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq /Users/eco/seq/chr1.fa calib-36.dat > maqdemo/true.snp' at /usr/local/bin/maq.pl line 842.[/SIZE]

Second, I would recreate a small reference from scratch (I just did what you describe with bbedit and it works fine). Could be either non-printing characters (bad line endings), or a strange character in the name definition line. Post up the header and first few lines.

Last, have you checked that all the scripts are in either the same directory or your path (maq.pl, and maq_eval.pl, should both work standalone).

[ECO]

Just noticed this...something is wrong with either your data file or your version of maq.pl. See bolded region in your error message below (and compare to my successful run above)...it's launching with the wrong filename for the .dat file...

My hints above were with 0.6.8. The only version I've found where most things work well for me.

I have downloaded Maq & am trying to get the program to work.
When I try to run Maq I get this output

maq.pl demo ref.fasta calib-36.dat
-- CMD: mkdir -p maqdemo
-- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
calib-30.dat > maqdemo/true.snp
> > /usr/bin/maq: line 1: .": command not found
> > /usr/bin/maq: line 2: .": command not found
> > /usr/bin/maq: line 3: .": command not found
> > /usr/bin/maq: line 4: .": command not found
> > /usr/bin/maq: line 5: .de: command not found
> > /usr/bin/maq: line 6: .br: command not found
> > /usr/bin/maq: line 7: .if: command not found
> > /usr/bin/maq: line 8: .ne: command not found
> > /usr/bin/maq: line 9: .PP: command not found
> > /usr/bin/maq: line 10: fB\simulatefR: command not found
> > /usr/bin/maq: line 11: .PP: command not found
> > /usr/bin/maq: line 12: ..: command not found
> > /usr/bin/maq: line 13: syntax error near unexpected token `('
> > /usr/bin/maq: line 13: `.de Sp \" Vertical space (when we can't use .PP)'
> > ** fail to run command '/usr/bin/maq simulate -N 1000000 maqdemo/r1.fq
> > maqdemo/r2.fq ref.fasta calib-30.dat > maqdemo/true.snp' at /usr/bin/
> > maq.pl line 842.


If I try to run maq.pl easyrun -d outdir ref.fasta reads.fastq command I get

-- CMD: /usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null
** fail to run command '/usr/bin/maq fasta2bfa
/Users/jozefgecz/Documents/Alison/Maq/maq-0.7.0/ref.fasta outdir/ref.bfa 2>
/dev/null' at /usr/bin/maq.pl line 842.

I save my ref.fasta file in Bbedit as Unix format. I'm not a bioinformatician
so am struggling.

any help would be greatly appreciated

alig

[ECO]

last but not least I'm going to move this to the Bioinformatics forum to get more eyes on it.

[alig]

Hi Eco,

Firstly thank you very much for your quick reply.

I did download maq-data (calib-36.dat file) And very sorry for the confusion but I just cut & pasted the output from an email I sent to Heng Li who said I was using the wrong .dat file (calib-30.dat) for maq-0.7.0. But using calib-36.dat made no difference to the output.

This is the first few lines of my ref. fasta file
>Salmonella typhi 45kb
aaggaatttttttgactgggtccgggagacgtacctaaaatttaacaattcttggggagg
tggctgggaaaatgaggtgccccaaataatcccgatgatgaatgatgaaggattgctgga
gtgcccattttgcggttcgctgaaggtttacctgttcgacgagttggttttatctcatgg
gtcttgctcgtcatgcgatgcgcgcacagatgaccactttgatgcttctatggctgtgaa
gtcatggaacacccgcaacgggcacgtctacaccgctgacgacttcagtcgggcagcaga

all the scripts are in the same usr/bin directory.

But I did have to rename the maq.1 script to maq & am assuming that it is an executable.

alig

[ECO]

Hrm. I had nothing but problems with 0.7.0 and 0.7.1, so went back to 0.6.8.

Not sure why you renamed that script...maq.1 looks like the man pages for the program. That's undoubtedly your problem there...it's trying to execute whatever markup is used for man pages.

Did you compile maq?

[xuer]

maybe you have fixed the froblem.if not,
look the command below, are you using calib-30.dat or calib-36.dat?

maybe it is the reason. if you can see the message soon.

-- CMD: /usr/bin/maq simulate -N 1000000 maqdemo/r1.fq maqdemo/r2.fq ref.fasta
calib-30.dat > maqdemo/true.snp

[alig]

maq problems

I renamed the script...maq.1 as it was looking for maq in the same directory as maq.pl & maq_eval.pl & couldn't find maq as there wasn't a file of that name I assumed.

That is probably my problem then if it is actually the man pages. I might try an earlier version then - 0.6.8

thanks a lot for all your help so far everyone

alig

[alig]

Maq problems

I did compile maq, but I can never find a maq executable

The maq.pl & maq_eval.pl scripts come in maqview I think, & I have them

but there is only maq.1 not maq so I always get the ouput

maq.pl easyrun -d outdir ref.fasta reads.fastq
[gwhich] fail to find executable maq anywhere. at /usr/bin/maq.pl line 883.
** Cannot find 'maq' executable. at /usr/bin/maq.pl line 77.

alig

[andpet]

getting maq started

Hi,

the file maq.1 is definitly the man page, so it makes no sense to rename it to get the executable. The missing executable seems to be the problem

Maybe it is the best if you recompile your maq version (make clean first then ./configure; make; make install) and post any errors that occurred ?

Andreas

[valeu]

Hrm. I had nothing but problems with 0.7.0 and 0.7.1, so went back to 0.6.8.

Did you compile maq?

Oh thank you so much! I tried everything to make maq 0.7.1 work! I managed to compile it but then I got "Segmentation error" trying to run it..
And with 0.6.8 it's fine!

Valentina

[alig]

Hi Andreas,

When I type 'make' I get this error message

/Documents/Alison/Maq/maq-0.6.8 jozefgecz$ make
cd . && /bin/sh /Users/jozefgecz/Documents/Alison/Maq/maq-0.6.8/missing --run autoheader
aclocal.m4:17: error: this file was generated for autoconf 2.61.
You have another version of autoconf. If you want to use that,
you should regenerate the build system entirely.
aclocal.m4:17: the top level
autom4te: /usr/bin/gm4 failed with exit status: 63
autoheader: /usr/bin/autom4te failed with exit status: 63
WARNING: `autoheader' is probably too old. You should only need it if
you modified `acconfig.h' or `configure.ac'. You might want
to install the `Autoconf' and `GNU m4' packages. Grab them
from any GNU archive site.

......and at the very end - ld64-62.1 failed: symbol(s) not found
collect2: ld returned 1 exit status
make[1]: *** [maq] Error 1
make: *** [all] Error 2


I have downloaded & compiled autoconf 2.61 & GNU M4 1.4.9 but it still seems to be finding the built-ins (You have another version of autoconf) & not the newer version just installed.

alig

[ECO]

Looks like that's a Mac...have you installed the developers tools ("Xcode" if i remember correctly) ??

[alig]

Maq problems

Hi Eco,

Yes it's a Mac OS X 10.4.11 & so has Xcode 2.4.1 installed on it.

but the autoconf is only version 2.59 & gm4 is version 1.4.2

So I was trying to install more recent versions. But it's still looking at the built-ins & not the newer more recently installed versions

alig

[alig]

Maq problems

I have just noticed this error when compiling maq-0.6.8 with 'make'

ld64 warning: in /usr/lib/libz.dylib, file is not of required architecture

I am running it on a PowerPC G4 Mac but also get the same error on a G5

even though the Maq webpage says that - "Compiling as a 32bit executable should work but the speed will be affected"

Do I just need to somehow get different libraries or should I just give up now !!!

exasperated alig