Yes I do, many thanks for all your help!!
Now that I know whats going on I can handle this in my sam parser.
And maybee the people from Sanger will find some time to fix this in one of the next versions - I will send a bug report.
thanks ro
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Yes they are subsequent entries in the fasta file! It is the insert of a LTR transposon followed by the LTR, i.e.: this sequences are frequently found in exactly this order in the different species.
This could be an explanation for the problem than. If BWA is concatenating the sequences and measuring the distance between the mates, than it finds the difference is correct, while ignoring the fact that a contig boundary is crossed, and thus assigns the flag mapped in a proper pair.
Leave a comment:
-
I was under the impression that BWA concatenates all the references together and aligns reads against that long string. Might it have something to do with that?
Leave a comment:
-
Is there any obvious link between the contigs, in particular are they subsequent entries in the FASTA reference file?
Leave a comment:
-
Mapper: bwa
Version: 0.57
command bwa aln -n 0.01 -o 2 -e 12 -d 12 -t 2 etc
Leave a comment:
-
Could be a bug in the mapping tool used. What tool and what version was it?
Leave a comment:
-
bwa sampe: proper pair but on different contigs!!??!!
Dear all,
Does anyone have an idea how the following is possible:
I have reads mapped in a proper pair (as indicated by the sam-flag) but they map to different contigs!!!???
HWUSI-EAS300R:7:1:15:1404#0 147 FW_DM_LINE_Jockey 128 29 74M FW3_DM_LINE_Jockey 3131 0 TGCAAGATCGCTTAAATACATAGTGAATTGTTATCTTAAATAATAAAACTATGAGTCAGAATGACACTCGCGCC Y^S[]^\[]a_XSZ[_]]_`_`]```_^a^`^`[aa__`]V]```aa\a_`]aaaaaaaa`Ta\a`aaaba`aa XT:A:U NM:i:0 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:74
HWUSI-EAS300R:7:1:15:1495#0 147 Gypsy4_LTR_LTR_Gypsy 112 60 74M Gypsy4_I_LTR_Gypsy 6216 0 CATTCCACTGCCCGGAGCGTGTGAAGCGCAATGTCAGCATTCTGCCGTGAGCGCTGCTTCAAAAGACGGGCTAC XUPM^NHLSMW\SWSPM\MW]PW\TZ\aPMP^MS^S]]Z^M_^X]^Z^]Z^]`a]^Z_\aaS]Z`Sa]a`_a\a XT:A:U NM:i:3 XN:i:1 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:5T32C22G12
HWUSI-EAS300R:7:1:22:1504#0 147 FW_DM_LINE_Jockey 85 29 74M FW3_DM_LINE_Jockey 3125 0 AACTAAATAAAAAATCTGAAAGCGAAAGAGACGCTCTATGCGATGCAAGATCGCTTAAATACATAGTGAATTGT ]N^I_^WG[[[_YNFQP[XGM\_^^S\a__^``_Y[a^\_a_```aaa`a]a`a````ba_baa`a_bbaabaa XT:A:U NM:i:0 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:74
HWUSI-EAS300R:7:1:25:1975#0 83 BLOOD_I_LTR_Gypsy 145 29 13M3D61M BLASTOPIA_LTR_LTR_Gypsy 271 0
best roTags: None
Latest Articles
Collapse
-
by seqadmin
The field of immunogenetics explores how genetic variations influence immune responses and susceptibility to disease. In a recent SEQanswers webinar, Oscar Rodriguez, Ph.D., Postdoctoral Researcher at the University of Louisville, and Ruben MartÃnez Barricarte, Ph.D., Assistant Professor of Medicine at Vanderbilt University, shared recent advancements in immunogenetics. This article discusses their research on genetic variation in antibody loci, antibody production processes,...-
Channel: Articles
Yesterday, 07:24 PM -
-
by seqadmin
Next-generation sequencing (NGS) and quantitative polymerase chain reaction (qPCR) are essential techniques for investigating the genome, transcriptome, and epigenome. In many cases, choosing the appropriate technique is straightforward, but in others, it can be more challenging to determine the most effective option. A simple distinction is that smaller, more focused projects are typically better suited for qPCR, while larger, more complex datasets benefit from NGS. However,...-
Channel: Articles
10-18-2024, 07:11 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 11-01-2024, 06:09 AM
|
0 responses
24 views
0 likes
|
Last Post
by seqadmin
11-01-2024, 06:09 AM
|
||
New Model Aims to Explain Polygenic Diseases by Connecting Genomic Mutations and Regulatory Networks
by seqadmin
Started by seqadmin, 10-30-2024, 05:31 AM
|
0 responses
21 views
0 likes
|
Last Post
by seqadmin
10-30-2024, 05:31 AM
|
||
Started by seqadmin, 10-24-2024, 06:58 AM
|
0 responses
25 views
0 likes
|
Last Post
by seqadmin
10-24-2024, 06:58 AM
|
||
New AI Model Designs Synthetic DNA Switches for Targeted Gene Expression in Specific Cell Types
by seqadmin
Started by seqadmin, 10-23-2024, 08:43 AM
|
0 responses
56 views
0 likes
|
Last Post
by seqadmin
10-23-2024, 08:43 AM
|
Leave a comment: