Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • GoneSouth
    replied
    Yes I do, many thanks for all your help!!
    Now that I know whats going on I can handle this in my sam parser.
    And maybee the people from Sanger will find some time to fix this in one of the next versions - I will send a bug report.
    thanks ro

    Leave a comment:


  • maubp
    replied
    Originally posted by GoneSouth View Post
    Yes they are subsequent entries in the fasta file!
    Given Lee Sam's post you can probably see why I asked that

    i.e. This is probably a bug in BWA, wrongly marking the reads as "properly paired".

    Leave a comment:


  • GoneSouth
    replied
    Yes they are subsequent entries in the fasta file! It is the insert of a LTR transposon followed by the LTR, i.e.: this sequences are frequently found in exactly this order in the different species.
    This could be an explanation for the problem than. If BWA is concatenating the sequences and measuring the distance between the mates, than it finds the difference is correct, while ignoring the fact that a contig boundary is crossed, and thus assigns the flag mapped in a proper pair.

    Leave a comment:


  • Lee Sam
    replied
    I was under the impression that BWA concatenates all the references together and aligns reads against that long string. Might it have something to do with that?

    Leave a comment:


  • maubp
    replied
    Is there any obvious link between the contigs, in particular are they subsequent entries in the FASTA reference file?

    Leave a comment:


  • GoneSouth
    replied
    Mapper: bwa
    Version: 0.57
    command bwa aln -n 0.01 -o 2 -e 12 -d 12 -t 2 etc

    Leave a comment:


  • maubp
    replied
    Could be a bug in the mapping tool used. What tool and what version was it?

    Leave a comment:


  • bwa sampe: proper pair but on different contigs!!??!!

    Dear all,


    Does anyone have an idea how the following is possible:
    I have reads mapped in a proper pair (as indicated by the sam-flag) but they map to different contigs!!!???

    HWUSI-EAS300R:7:1:15:1404#0 147 FW_DM_LINE_Jockey 128 29 74M FW3_DM_LINE_Jockey 3131 0 TGCAAGATCGCTTAAATACATAGTGAATTGTTATCTTAAATAATAAAACTATGAGTCAGAATGACACTCGCGCC Y^S[]^\[]a_XSZ[_]]_`_`]```_^a^`^`[aa__`]V]```aa\a_`]aaaaaaaa`Ta\a`aaaba`aa XT:A:U NM:i:0 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:74
    HWUSI-EAS300R:7:1:15:1495#0 147 Gypsy4_LTR_LTR_Gypsy 112 60 74M Gypsy4_I_LTR_Gypsy 6216 0 CATTCCACTGCCCGGAGCGTGTGAAGCGCAATGTCAGCATTCTGCCGTGAGCGCTGCTTCAAAAGACGGGCTAC XUPM^NHLSMW\SWSPM\MW]PW\TZ\aPMP^MS^S]]Z^M_^X]^Z^]Z^]`a]^Z_\aaS]Z`Sa]a`_a\a XT:A:U NM:i:3 XN:i:1 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:5T32C22G12
    HWUSI-EAS300R:7:1:22:1504#0 147 FW_DM_LINE_Jockey 85 29 74M FW3_DM_LINE_Jockey 3125 0 AACTAAATAAAAAATCTGAAAGCGAAAGAGACGCTCTATGCGATGCAAGATCGCTTAAATACATAGTGAATTGT ]N^I_^WG[[[_YNFQP[XGM\_^^S\a__^``_Y[a^\_a_```aaa`a]a`a````ba_baa`a_bbaabaa XT:A:U NM:i:0 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:74
    HWUSI-EAS300R:7:1:25:1975#0 83 BLOOD_I_LTR_Gypsy 145 29 13M3D61M BLASTOPIA_LTR_LTR_Gypsy 271 0
    Hope anyone can help on this!!
    best ro

Latest Articles

Collapse

  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 08:52 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 08:57 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
49 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-12-2024, 03:37 PM
0 responses
425 views
0 likes
Last Post seqadmin  
Working...
X