Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • fungs
    replied
    Just to let you know: Here is some evidence on the issue. I checked different versions and engines of NCBI BLAST. This seems to be an optimization in the code that is on purpose. The effect is that raw score can differ up to 3 points from real score.

    blast2.2.24+:

    * * * <Parameters_expect>10000</Parameters_expect>
    * * * <Parameters_sc-match>2</Parameters_sc-match>
    * * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
    * * * <Parameters_gap-open>5</Parameters_gap-open>
    * * * <Parameters_gap-extend>2</Parameters_gap-extend>
    * * * <Parameters_filter>F</Parameters_filter>

    * * * * * * * <Hsp_num>1</Hsp_num>
    * * * * * * * <Hsp_bit-score>176.213077892943</Hsp_bit-score>
    * * * * * * * <Hsp_score>194</Hsp_score>
    * * * * * * * <Hsp_evalue>6.28580662796915e-42</Hsp_evalue>
    * * * * * * * <Hsp_query-from>1</Hsp_query-from>
    * * * * * * * <Hsp_query-to>100</Hsp_query-to>
    * * * * * * * <Hsp_hit-from>108</Hsp_hit-from>
    * * * * * * * <Hsp_hit-to>9</Hsp_hit-to>
    * * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
    * * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
    * * * * * * * <Hsp_identity>99</Hsp_identity>
    * * * * * * * <Hsp_positive>99</Hsp_positive>
    * * * * * * * <Hsp_gaps>0</Hsp_gaps>
    * * * * * * * <Hsp_align-len>100</Hsp_align-len>
    * * * * * * *
    <Hsp_qseq>TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGA</Hsp_qseq>
    * * * * * * *
    <Hsp_hseq>TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGTGTGA</Hsp_hseq>
    * * * * * * *
    <Hsp_midline>||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
    </Hsp_midline>

    ================================================================================
    blast2.2.24:

    * * * <Parameters_expect>10000</Parameters_expect>
    * * * <Parameters_sc-match>2</Parameters_sc-match>
    * * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
    * * * <Parameters_gap-open>5</Parameters_gap-open>
    * * * <Parameters_gap-extend>2</Parameters_gap-extend>
    * * * <Parameters_filter>F</Parameters_filter>

    * * * * * * * <Hsp_num>1</Hsp_num>
    * * * * * * * <Hsp_bit-score>176.213</Hsp_bit-score>
    * * * * * * * <Hsp_score>194</Hsp_score>
    * * * * * * * <Hsp_evalue>6.28581e-42</Hsp_evalue>
    * * * * * * * <Hsp_query-from>100</Hsp_query-from>
    * * * * * * * <Hsp_query-to>1</Hsp_query-to>
    * * * * * * * <Hsp_hit-from>9</Hsp_hit-from>
    * * * * * * * <Hsp_hit-to>108</Hsp_hit-to>
    * * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
    * * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
    * * * * * * * <Hsp_identity>99</Hsp_identity>
    * * * * * * * <Hsp_positive>99</Hsp_positive>
    * * * * * * * <Hsp_align-len>100</Hsp_align-len>
    * * * * * * *
    <Hsp_qseq>TCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_qseq>
    * * * * * * *
    <Hsp_hseq>TCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_hseq>
    * * * * * * *
    <Hsp_midline>|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    </Hsp_midline>

    ================================================================================

    blast2.2.24-legacy:

    * * * <Parameters_expect>10000</Parameters_expect>
    * * * <Parameters_sc-match>2</Parameters_sc-match>
    * * * <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
    * * * <Parameters_gap-open>5</Parameters_gap-open>
    * * * <Parameters_gap-extend>2</Parameters_gap-extend>
    * * * <Parameters_filter>F</Parameters_filter>

    * * * * * * * <Hsp_num>1</Hsp_num>
    * * * * * * * <Hsp_bit-score>177.115</Hsp_bit-score>
    * * * * * * * <Hsp_score>195</Hsp_score>
    * * * * * * * <Hsp_evalue>3.36455e-42</Hsp_evalue>
    * * * * * * * <Hsp_query-from>100</Hsp_query-from>
    * * * * * * * <Hsp_query-to>1</Hsp_query-to>
    * * * * * * * <Hsp_hit-from>9</Hsp_hit-from>
    * * * * * * * <Hsp_hit-to>108</Hsp_hit-to>
    * * * * * * * <Hsp_query-frame>1</Hsp_query-frame>
    * * * * * * * <Hsp_hit-frame>-1</Hsp_hit-frame>
    * * * * * * * <Hsp_identity>99</Hsp_identity>
    * * * * * * * <Hsp_positive>99</Hsp_positive>
    * * * * * * * <Hsp_align-len>100</Hsp_align-len>
    * * * * * * *
    <Hsp_qseq>TCACGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_qseq>
    * * * * * * *
    <Hsp_hseq>TCACACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGATCAATGGAACAGAACAGA</Hsp_hseq>
    * * * * * * *
    <Hsp_midline>|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    </Hsp_midline>

    Leave a comment:


  • fungs
    replied
    Yes thanks, I counterchecked with the latest BLAST+ version and found the same issue. The raw score is important to me because when I compare different aligners using the same scoring scheme should result in more or less the same alignments with the same raw scores.

    Another point is that BLAST bit scores are calculated from the raw scores. This would mean that also the bit scores are slightly wrong!

    I will write them an email, unfortunately they don't have a developers mailing list at the NCBI...

    Leave a comment:


  • robs
    replied
    If the raw score is a huge issue for you, you might want to consider alternative alignment programs (switch to an alternative program).
    You could also try to write the NCBI people who wrote the BLAST+ paper.

    Leave a comment:


  • fungs
    replied
    Yes, I am using BLAST+. I am currently running the latest version to see whether it makes any difference. Anyhow, this shoudn't be if it is really a bug. I couldn't find anything about it in the change logs from 2.2.22+ to 2.2.24+ so I rather think that it will give the same results with the latest version. What do you mean by "you should switch"?

    Leave a comment:


  • robs
    replied
    Did you try to use BLAST+ instead? If the problem does occur with BLAST+, I would switch. You might also want to update to the latest BLAST version.

    Leave a comment:


  • fungs
    started a topic Blast raw score calculation

    Blast raw score calculation

    Hello,

    I know this sounds strange but I am having problems to validate the BLAST raw alignment scores (not the bit scores). Here an example alignment:

    -------------------------------------------------------

    Query: 100009 (Length=100)

    Hit: NZ_ABBZ01004690 gi|153879981|ref|NZ_ABBZ01004690.1| Beggiatoa sp. PS, whole genome shotgun sequence
    Length=280

    Score = 176 bits (194), Expected = 6e-42
    Identities = 99/100 (99%), Gaps = 0/100 (0%)
    Strand=Plus/Minus

    TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGA
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
    TCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACTGTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGTGTGA

    -------------------------------------------------------

    My scoring matrix is:
    match: 2
    mismatch: -3
    gap open: 5
    gap extension: 2

    Following the formula from the NCBI web site http://www.ncbi.nlm.nih.gov/Educatio...t_Scores2.html (and what other aligners produce as raw score) this makes

    99*2 - 3 = 195 and not 194 like BLAST says:

    <Hsp_num>1</Hsp_num>
    <Hsp_bit-score>176.213077892943</Hsp_bit-score>
    <Hsp_score>194</Hsp_score>
    <Hsp_evalue>6.28580662796915e-42</Hsp_evalue>
    <Hsp_query-from>1</Hsp_query-from>
    <Hsp_query-to>100</Hsp_query-to>
    <Hsp_hit-from>108</Hsp_hit-from>
    <Hsp_hit-to>9</Hsp_hit-to>
    <Hsp_query-frame>1</Hsp_query-frame>
    <Hsp_hit-frame>-1</Hsp_hit-frame>
    <Hsp_identity>99</Hsp_identity>
    <Hsp_positive>99</Hsp_positive>
    <Hsp_gaps>0</Hsp_gaps>
    <Hsp_align-len>100</Hsp_align-len>

    In fact I noticed that all BLAST raw scores are even! I am using BLAST version 2.2.22+. Do I miss an import point here?

Latest Articles

Collapse

  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM
  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 08:47 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
60 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
54 views
0 likes
Last Post seqadmin  
Working...
X