Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problem of insert size that was calculated by picard, thanks!


    I have made a test bam as follow, then I run CollectInsertSizeMetrics with this bam, however, I don't understand how the insert size was calculated, after google I still feel confused, so I look for help here. Any suggestion would be grateful!

    The bam is:
    1: ST-2047 2195 chr10 15766308 60 111H39M = 15767443 1098 AGTCCTCTCCTGGGCCTTGGGTTGAGGCTGAGTGATCTG KKKKKFKFFKFKKKKKKKKKKKKKKKKKFKKKKKFFFAA NM:i:0 MD:Z:39 AS:i:39 XS:i:19 SA:Z:chr10,15767753,-,69M81S,60,1;







    8: ST-49513 2177 chr3 34012850 0 106H44M chr9 46824220 0 TCTGAAAACAGATATTTCGGATCTCTTTGAAGATTTTAGTGCCA K,A7<,<F7<<FAFA,A,,,,<,,,<<A<FAA7,,,,7,,,,,< NM:i:3 MD:Z:5G29A3G4 AS:i:30 XS:i:29 SA:Z:chr14,66949070,+,64M86S,0,1;



    After run CollectInsertSizeMetrics, I got:
    insert_size All_Reads.fr_count All_Reads.rf_count
    379 1 0
    1401 0 1

    Following is my question:
    1) I think reads of ST-25745 and ST-49513 were discarded, since they were chimeric reads and map to different chromosome, am I right?
    2) Then I confirmed the 379 was the insert of ST-2047 by running CollectInsertSizeMetrics with these reads. I guess the first alignment with flag 2195 was discarded, then the insert size should be 15767553+69-15767443=179, I have no idea of the 379?
    3) For ST-43730, I think it should be 49545057+150-49423551=1656, even add the 43S, it should be 1656+43=1699, how 1401 was produced?
    4) For the orientation of reads, for ST-2042, the flag of second reads is 147 (128+16+2+1), the 16 means the SEQ was complemented, so the orientation is FR. For ST-43730, the flag of second reads is 163 (128+32+2+1), 32 means the paired reads (first reads) was complemented, so the orientation is RF, am I right?
    5) In fact, I had a library of 2K insert size, but after mapping with bwa and run with CollectInsertSizeMetrics, I got the insert size about 270~300bp, and the orientation is FR, I think the experiment was failed, that is I failed to link reads in 2K distance to a single fragment before sequencing, so I check the bam, then encountered the problem above, any suggestion about the potential reason why I got wrong insert size of the 2K library would be grateful.

    Thanks for advance!
    Best wishes!

Latest Articles


  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin

    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    Yesterday, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin

    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM





Topics Statistics Last Post
Started by seqadmin, Yesterday, 07:15 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
Last Post seqadmin  