Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • GenoMax
    replied
    One alternative would be to change all spaces to "_" so that you have a long string (that should stay unique) for each fasta header. It would be cumbersome but would at least avoid the problem @kmcarr pointed out.

    Leave a comment:


  • kmcarr
    replied
    Originally posted by Katty1 View Post
    I did a script in Perl that breaks several sequences of a multifasta file, but I need remove a part of string of header.

    For example:

    input file:
    Code:
    >gi|983431797|ref|NZ_LN868938.1| Nocardia farcinica genome assembly NCTC11134, chromosome : 1
    CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
    CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT
    Output file:
    Code:
    >Nocardia farcinica genome assembly NCTC11134, chromosome : 1
    CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
    CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT
    Katty,

    I would caution you that what you plan to do is potentially problematic. The generally accepted format for FASTA file deflines is that the first word after the ">" represents the unique identifier for the sequence. The "first word" is defined as everything up to the first "whitespace" which may be a space or tab character. Everything that comes after that is optional description text. If you also have included in your analysis:

    Code:
    >gi|873551602|emb|LN868939.1| Nocardia farcinica genome assembly NCTC11134, plasmid : 2
    GGCTTTGTGCCCGCCGAAAAAAGGTTGCCTATGTCCAAGCCTGCATTTACCGAAATCGACCGAATGACGG
    GCGGAGGGCGGAGTAATCGCACCCGCCCACCGGTCAACTTCCTTCTTCACACCGAGGAAGGAAACTCGAG...
    Which you also edit to:

    Code:
    >Nocardia farcinica genome assembly NCTC11134, plasmid : 2
    GGCTTTGTGCCCGCCGAAAAAAGGTTGCCTATGTCCAAGCCTGCATTTACCGAAATCGACCGAATGACGG
    GCGGAGGGCGGAGTAATCGCACCCGCCCACCGGTCAACTTCCTTCTTCACACCGAGGAAGGAAACTCGAG...
    You have two sequences as part of your analysis which share the same ID, "Nocardia".

    Leave a comment:


  • SNPsaurus
    replied
    Can you just split on " " and print the second element of the split array? Or split on '|' and take the last element. It just depends on how standard the formatting is of the header.
    @header_split = split(" ",$line);
    $changed_line = $header_split[1];

    Leave a comment:


  • How do I remove a part of the header of a fasta file in perl?

    I did a script in Perl that breaks several sequences of a multifasta file, but I need remove a part of string of header.

    For example:

    input file:
    >gi|983431797|ref|NZ_LN868938.1| Nocardia farcinica genome assembly NCTC11134, chromosome : 1
    CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
    CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT

    Output file:
    >Nocardia farcinica genome assembly NCTC11134, chromosome : 1
    CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
    CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT

    I've done everything, but I can't think of a solution to this.
    Can someone help me?

    My script:

    #!/usr/bin/perl

    use strict;
    use warnings;
    use IO::File;

    my $file = "\nFILE: perl $0 <Fasta>"."\n";
    print $file and exit unless($ARGV[0]);
    my $input = IO::File->new("$ARGV[0]"), my $output;
    while(my $line = $input->getline){
    chomp($line);
    if($line =~ /^>/){
    $line =~ s/^>//;
    $output = IO::File->new("> $line.fa");
    print $output ">".$line."\n";
    }else{
    print $output $line."\n";
    }
    }
    close($input);
    close($output);

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 07:24 AM
0 responses
9 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 08:58 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
184 views
0 likes
Last Post seqadmin  
Working...
X