Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Error found while mapping Illumina data using BWA

    While mapping Illumina data against BWA, I noticed several errors :

    ERROR: Record 58, Read name HWI-ST142_0217:1:63:8795:27966#0, Mate negative strand flag does not match read negative strand flag of mate

    The corresponding reads are

    HWI-ST142_0217:1:63:8795:27966#0 89 chr1 27 0 52M1D48M = 27 0 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGAACCCAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTA BBBBBBB___T^^ddc^bccddYdaa``]^O_U]\bGbbbZ_PZ\ZPT\Zbdaadeeee`ddddd`caccb\bbbbb\bbdcTdddcadddd`dadcdcdXT:A:R NM:i:3 SM:i:0 AM:i:0 X0:i:3 X1:i:1 XM:i:2 XO:i:1 XG:i:1 MD:Z:46T5^T29A18 XA:Z:chr15,+100338770,17M1D83M,3;chr4,-62,82M1D18M,3;chr1,-21,52M1D48M,4;

    HWI-ST142_0217:1:63:8795:27966#0 181 chr1 27 0 * = 27 0 GGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTGGTTAGGG bT\^`^bddad\bdadbbdd``Yc`b\d`dbdd^d`ccc\`bYb`TUXYPeT\eecfdfdeeccfcefcfe\eeccfefeffeffffffffffcfcfeff

    The flag of these reads show up as

    1 0 1 1 0 0 1 - first read (forward strand of mate, reverse strand of query)
    1 0 1 1 0 1 0 1 - second read (reverse strand of mate, reverse strand of query)

    The sixth bit (from the left) for both these reads (mate strand) conflicts with the fifth bit (strand of the query).

    Is this the reason for the error I am seeing ? Is there a way to prevent such errors from occurring ?
    Last edited by nirav99; 09-02-2010, 01:47 PM. Reason: Adding new line for clarity of reading

  • #2
    Picard's command line utility FixMateInformation fixes this error.


    • #3
      hi, nirav99

      I got the same error "Mate negative strand flag does not match read negative strand flag of mate" and I tried FixMateInformation as:

      java -Xmx2g -jar FixMateInformation.jar INPUT=test.bam OUTPUT=test_fixed.bam VALIDATION_STRINGENCY=SILENT

      but I didn't get the output file and got this error:
      Exception in thread "main" net.sf.samtools.util.RuntimeIOException: Write error; BinaryCodec in writemode; streamed file (filename not available)
      at net.sf.samtools.util.BinaryCodec.writeBytes(
      at net.sf.samtools.util.BinaryCodec.writeBytes(
      at net.sf.samtools.BAMRecordCodec.encode(
      at net.sf.samtools.BAMRecordCodec.encode(
      at net.sf.samtools.util.SortingCollection.spillToDisk(
      at net.sf.samtools.util.SortingCollection.add(
      at net.sf.picard.sam.FixMateInformation.doWork(
      at net.sf.picard.cmdline.CommandLineProgram.instanceMain(
      at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(
      at net.sf.picard.sam.FixMateInformation.main(
      Caused by: No space left on device
      at Method)
      at net.sf.samtools.util.BinaryCodec.writeBytes(



      • #4
        Hi Cliff,

        Please check the disk space where you are running this. The exception indicates

        "Caused by: No space left on device"


        • #5
          thanks for getting back to me. I actually have 15TB left..


          • #6
            Could it be that the temporary path is not pointing towards your 15TB?


            • #7
              The scratching happens in /tmp/<user_name>, so the problem was most likely /tmp. Use TMP_DIR to specify a different temporary dir.


              • #8
                I specified a temporary directory which has enough space by

                java -Xmx4g -jar

                it still failed...


                • #9
                  Hi Cliff,

                  TMP_DIR is a command line parameter for Picard tools.

                  So, the way to do it would be

                  java -Xmx4G -jar FixMateInformation.jar I=input.bam O=output.bam TMP_DIR=/home/temp VALIDATION_STRINGENCY=LENIENT


                  • #10
                    Hi, Nirav99

                    Thanks! I tried your command and still failed..


                    • #11
                      Similar error found when using SortSam

                      Hi Cliff. Did you find a solution to your problem? I'm getting the same error, except for me it occurs when calling SortSam. Similar to your case we have lots of space available (62 TB).

                      java -Xmx20g -Xms8g -jar SortSam.jar MAX_RECORDS_IN_RAM=2000000 VALIDATION_STRINGENCY=LENIENT CREATE_INDEX=true SORT_ORDER=coordinate INPUT=sequence.sam OUTPUT=sequence.sorted.bam

                      Exception in thread "main" net.sf.samtools.util.RuntimeIOException: Write error; BinaryCodec in writemode; streamed file (filename not available)
                      at net.sf.samtools.util.BinaryCodec.writeBytes(
                      at net.sf.samtools.util.BinaryCodec.writeBytes(
                      at net.sf.samtools.util.BinaryCodec.writeString(
                      at net.sf.samtools.BinaryTagCodec.writeTag(
                      at net.sf.samtools.BAMRecordCodec.encode(
                      at net.sf.samtools.BAMRecordCodec.encode(
                      at net.sf.samtools.util.SortingCollection.spillToDisk(
                      at net.sf.samtools.util.SortingCollection.add(
                      at net.sf.samtools.SAMFileWriterImpl.addAlignment(
                      at net.sf.picard.sam.SortSam.doWork(
                      at net.sf.picard.cmdline.CommandLineProgram.instanceMain(
                      at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(
                      at net.sf.picard.sam.SortSam.main(
                      Caused by: No space left on device
                      at Method)
                      at net.sf.samtools.util.BinaryCodec.writeBytes(
                      ... 12 more

                      Originally posted by cliff View Post
                      Hi, Nirav99

                      Thanks! I tried your command and still failed..


                      • #12
                        Picard java exception

                        Hi I got similar error using Picard MergeSamFiles.jar
                        Wondering if anyone found an answer for it

                        Exception in thread "main" net.sf.samtools.util.RuntimeIOException: /scratch/temp/sortingcollection.4193001834577553277.tmp (Too many open files)
                        at net.sf.samtools.util.SortingCollection$FileRecordIterator.<init>(
                        at net.sf.samtools.util.SortingCollection$MergingIterator.<init>(
                        at net.sf.samtools.util.SortingCollection.iterator(
                        at net.sf.samtools.util.SortingCollection.iterator(
                        at net.sf.samtools.SAMFileWriterImpl.close(
                        at net.sf.samtools.AsyncSAMFileWriter.synchronouslyClose(
                        at net.sf.samtools.util.AbstractAsyncWriter.close(
                        at net.sf.picard.sam.MergeSamFiles.doWork(
                        at net.sf.picard.cmdline.CommandLineProgram.instanceMain(
                        at net.sf.picard.sam.MergeSamFiles.main(
                        Caused by: /scratch/temp/sortingcollection.4193001834577553277.tmp (Too many open files)
                        at Method)
                        at<init>(Unknown Source)
                        at net.sf.samtools.util.SortingCollection$FileRecordIterator.<init>(
                        ... 9 more
                        Even in my case the space available in /scratch is around 40T


                        • #13
                          If anyone is still listening to this thread - what versions of bwa is everyone using who is getting this error?


                          • #14
                            I did not use bwa. I used SHRiMP 2.2.2 for mapping. samtools 1.8 for converting sam to bam and Picard version: 1.74 for combining mapped bam files.


                            • #15
                              Regarding the (Too many open files), there are a number of things to do. Picard sorting seems to open so many files that it can overload default limits on unix systems. To deal with this, you can either (1) ask you sys admin to increase the allowable number of open files using ulimit -n or (2) for some picard programs you can increase the value of the MAX_RECORDS_IN_RAM command-line parameter which instructs Picard to store more records in fewer files and reduce the number of open files. (watch out for increased memory usage though). If your using markdups and see this error you can 3) use the command-line para
                              meter MAX_FILE_HANDLES_FOR_READ_ENDS_MAP. By reducing this number, you reduce the number of concurrently open files.

                              On our hpc, ulimit -n == 4096, so I use MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=4000


                              Latest Articles


                              • seqadmin
                                Current Approaches to Protein Sequencing
                                by seqadmin

                                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                                04-04-2024, 04:25 PM
                              • seqadmin
                                Strategies for Sequencing Challenging Samples
                                by seqadmin

                                Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                                03-22-2024, 06:39 AM





                              Topics Statistics Last Post
                              Started by seqadmin, 04-11-2024, 12:08 PM
                              0 responses
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 10:19 PM
                              0 responses
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 09:21 AM
                              0 responses
                              Last Post seqadmin  
                              Started by seqadmin, 04-04-2024, 09:00 AM
                              0 responses
                              Last Post seqadmin  