Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • correct syntax for species delimitation in a maf file

    Hi,

    I want to analyse and manipulate genome alignments with maffilter. So far I have only aligned two de-novo assembled genomes with LAST but as far as I can see, this can only align two genomes (which for now is sufficient, but for next genomes I have to switch to something like Mugsy I think).
    But my problem for now is, how to specify species in the maf-file? The assembled scaffolds were given as two multiple fasta files to LAST, with sequence names scaffold_1, _2 etc., and that is what maffilter is complaining about (scaffold_7 invalid sequence name). So somewhere the species have to be defined (although in a two species alignment where one is the reference this should be no problem?).

    I have researched the internet and nowhere I could find any clear statement how the sequences have to be named correctly either in the source fasta or in the resulting maf.

    Below is the first part of the two genome maf.

    Someone has an idea?

    Thanks!
    Code:
    # LAST version 553
    #
    # a=7 b=1 A=7 B=1 e=35 d=14 x=34 y=7 z=34
    # R=11 u=2 s=2 T=0 m=100 l=1 n=100 k=1 i=8192 w=1000 t=0.727769 g=1 j=3 Q=0
    # triaddb
    # Reference sequences=174 normal letters=91719965
    #
    #    A  C  G  T
    # A  1 -3 -3 -3
    # C -3  1 -3 -3
    # G -3 -3  1 -3
    # T -3 -3 -3  1
    #
    # Coordinates are 0-based.  For - strand matches, coordinates
    # in the reverse complement of the 2nd sequence are used.
    #
    # name start alnSize strand seqSize alignment
    #
    # m=1 s=35
    #
    a score=15539 mismap=1e-10
    s scaffold_7 1976237 16386 + 5881857 AGTAGTATGACAATGTTGATAAAACTTACGGTTCGGCTTCTAACGAGCTGATCTCAGCAACATAATTGCAGGGAATATAACCACGTAAGCCGCTACGTCT

  • #2
    Hello, I know that this is an old question, but may be it can help to someone using maffilter. I had the same problem and looking at the source code I figured out that maffilter is parsing sequence name and is expecting do there.
    I resolved the problem by renaming sequence names so that they contain dots

    Code:
    sed -i -e 's/scaffold_m16_p_1/mMolMol1.p1/g' test2.maf
    sed -i -e 's/scaffold_m19_p_1/mMyoMyo1.p1/g' test2.maf

    Comment

    Latest Articles

    Collapse

    • seqadmin
      The Impact of AI in Genomic Medicine
      by seqadmin



      Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
      02-26-2024, 02:07 PM
    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin


      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      ...
      02-08-2024, 06:33 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 02-28-2024, 06:12 AM
    0 responses
    27 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-23-2024, 04:11 PM
    0 responses
    74 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-21-2024, 08:52 AM
    0 responses
    81 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-20-2024, 08:57 AM
    0 responses
    69 views
    0 likes
    Last Post seqadmin  
    Working...
    X