Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • problem of viewing assembly data in Tablet

    Dear all:
    I want to use Tablet to view assembly data (afg file ) from velvet, but it show error messages when I import the data. Can someone tell me what is mean:
    “ an error has occurred while attempting to open the provided assembly.
    Tablet.io.ReadException:Tablet encountered a problem on line 200,968.258 of “velvet_asm.afg”.
    Error details:java.lang.NumberFormatException: Value out of range. Value:”65485” Radix:10 “.

    Thanks

  • #2
    If one of the Tablet authors doesn't spot this post, email [email protected] for help.

    Comment


    • #3
      Hi, I get the feeling (but can't be sure) that this is a malformed AFG file; possibly the quality scores given the error. If you could either strip out the relevant line from the file, or send me the whole file I could at least confirm this and see if there's anything that could be done about it.

      Comment


      • #4
        thanks a lot.
        the file is too large, so I strip some lines and post here.
        200,968,248 src:10943011
        200,968,249 off:-4
        200,968,250 clr:90,0
        200,968,251 }
        200,968,252 {TLE
        200,968,253 src:11541127
        200,968,254 off:-3
        200,968,255 clr:90,0
        200,968,256 }
        200,968,257 }
        200,968,258 {CTG
        200,968,259 iid:54
        200,968,260 eid:60-1
        200,968,261 seq:
        200,968,262 AGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTACTCGAGCCCGTAATACAACA
        200,968,263 GAGCGTCCTTAATAAATATTTCTATAAATATTTGATGTTTACCTTCCGAAAAAGGTACAT
        200,968,264 TGCCAACCTTATTTGATAAATGTGTAAACTAAGATAAGTGTTGAGATCGGATTTTGATAA
        200,968,265 AGGCATTTGTTTGGGGTGTATGAGTTGGGAAAAGAAACAACAATCATCTCTTGACCAGTT
        200,968,266 TTCCTACTACTAGTGTGTTATCATATAGCGTAAGAGTATGACATAGAGATTGAGAAACAG
        200,968,267 AAACTGAATCATAACGAACATCACAGAATTTACATTTCTACACAATTTTCAGAAAAAGTG
        200,968,268 GAGTGGTGATATATGCTTATTGTTCTACAAGTTCTCTTCATGCGTTTTTGTTTATCTATC

        Comment


        • #5
          Thanks,

          I'll look into this and get back to you.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Best Practices for Single-Cell Sequencing Analysis
            by seqadmin



            While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
            06-06-2024, 07:15 AM
          • seqadmin
            Latest Developments in Precision Medicine
            by seqadmin



            Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

            Somatic Genomics
            “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
            05-24-2024, 01:16 PM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Yesterday, 07:24 AM
          0 responses
          9 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-13-2024, 08:58 AM
          0 responses
          11 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-12-2024, 02:20 PM
          0 responses
          16 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-07-2024, 06:58 AM
          0 responses
          184 views
          0 likes
          Last Post seqadmin  
          Working...
          X