Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • problem of viewing assembly data in Tablet

    Dear all:
    I want to use Tablet to view assembly data (afg file ) from velvet, but it show error messages when I import the data. Can someone tell me what is mean:
    “ an error has occurred while attempting to open the provided assembly.
    Tablet.io.ReadException:Tablet encountered a problem on line 200,968.258 of “velvet_asm.afg”.
    Error details:java.lang.NumberFormatException: Value out of range. Value:”65485” Radix:10 “.

    Thanks

  • #2
    If one of the Tablet authors doesn't spot this post, email [email protected] for help.

    Comment


    • #3
      Hi, I get the feeling (but can't be sure) that this is a malformed AFG file; possibly the quality scores given the error. If you could either strip out the relevant line from the file, or send me the whole file I could at least confirm this and see if there's anything that could be done about it.

      Comment


      • #4
        thanks a lot.
        the file is too large, so I strip some lines and post here.
        200,968,248 src:10943011
        200,968,249 off:-4
        200,968,250 clr:90,0
        200,968,251 }
        200,968,252 {TLE
        200,968,253 src:11541127
        200,968,254 off:-3
        200,968,255 clr:90,0
        200,968,256 }
        200,968,257 }
        200,968,258 {CTG
        200,968,259 iid:54
        200,968,260 eid:60-1
        200,968,261 seq:
        200,968,262 AGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTACTCGAGCCCGTAATACAACA
        200,968,263 GAGCGTCCTTAATAAATATTTCTATAAATATTTGATGTTTACCTTCCGAAAAAGGTACAT
        200,968,264 TGCCAACCTTATTTGATAAATGTGTAAACTAAGATAAGTGTTGAGATCGGATTTTGATAA
        200,968,265 AGGCATTTGTTTGGGGTGTATGAGTTGGGAAAAGAAACAACAATCATCTCTTGACCAGTT
        200,968,266 TTCCTACTACTAGTGTGTTATCATATAGCGTAAGAGTATGACATAGAGATTGAGAAACAG
        200,968,267 AAACTGAATCATAACGAACATCACAGAATTTACATTTCTACACAATTTTCAGAAAAAGTG
        200,968,268 GAGTGGTGATATATGCTTATTGTTCTACAAGTTCTCTTCATGCGTTTTTGTTTATCTATC

        Comment


        • #5
          Thanks,

          I'll look into this and get back to you.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Recent Advances in Sequencing Analysis Tools
            by seqadmin


            The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
            05-06-2024, 07:48 AM
          • seqadmin
            Essential Discoveries and Tools in Epitranscriptomics
            by seqadmin




            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
            04-22-2024, 07:01 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 05-14-2024, 07:03 AM
          0 responses
          19 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-10-2024, 06:35 AM
          0 responses
          44 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-09-2024, 02:46 PM
          0 responses
          54 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 05-07-2024, 06:57 AM
          0 responses
          42 views
          0 likes
          Last Post seqadmin  
          Working...
          X