BLAST possibly returning different results

SEQanswers June Challenge Has Begun!

The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!

For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)

See less

Jona

Junior Member

Join Date: Aug 2017

Posts: 1
- Share
- Tweet
#1

BLAST possibly returning different results

08-08-2017, 03:00 AM

Hi to everyone,
this is my very first post and first of all I'd like to thanks Seqanswers for the possibility offered.

I've submitted the following sequence to BLASTN:
CTTGACAAGCTAGCTTTAGTTTAAAAACTCCAACTGCCAAAGGAATTAAATTTTTCTTAAAGTAGTATTTCTAAAATACAATTTTTTTGAATTAGTAGTA

among the results I received also a single match to the following organism:
Clostridium botulinum Ba4 str. 657 GenBank CP001083.1

so I tried and run BLASTN again specifying the organism in the Organism field of BLASTN.

Surprisingly I did obtain 4 matches now (apart from plasmid). They are highlighted in black as poor results but why did BLASTN provide them now only?

Thanks for any help

Last edited by Jona; 08-08-2017, 03:04 AM.
Tags: None

Previous template Next

A Review of Next-Generation Sequencing Methods for Studying Epigenetics—Part 1

by seqadmin

Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.

Methylation Detect...
- Channel: Articles
05-31-2023, 10:46 AM
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...
- Channel: Articles
05-23-2023, 12:26 PM
Variant Analysis and Genome Assembly: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

Continuing from our previous article, we share variant analysis and genome assembly tools recommended by our experts Dr. Medhat Mahmoud, Postdoctoral Research Fellow at Baylor College of Medicine, and Dr. Ming "Tommy" Tang, Director of Computational Biology at Immunitas and author of From Cell Line to Command Line.

Variant detection and analysis tools
Mahmoud classifies variant detection work into two main groups: short variants (<50...
- Channel: Articles
05-19-2023, 10:03 AM

Topics	Statistics	Last Post
Genetic Discoveries Transform Our Understanding of Primate Diversity and Behavior by seqadmin Started by seqadmin, 06-01-2023, 08:56 PM	0 responses 9 views 0 likes	Last Post by seqadmin 06-01-2023, 08:56 PM
Deep Sequencing Unearths Novel Genetic Variants: Enhancing Precision Medicine for Vascular Anomalies by seqadmin Started by seqadmin, 06-01-2023, 07:33 AM	0 responses 8 views 0 likes	Last Post by seqadmin 06-01-2023, 07:33 AM
Unveiling Genetic Associations Through Transcription Factor Binding Quantitative Trait Loci by seqadmin Started by seqadmin, 05-31-2023, 07:50 AM	0 responses 4 views 0 likes	Last Post by seqadmin 05-31-2023, 07:50 AM
Exploring French-Canadian Ancestry: Insights into Migration, Settlement Patterns, and Genetic Structure by seqadmin Started by seqadmin, 05-26-2023, 09:22 AM	0 responses 11 views 0 likes	Last Post by seqadmin 05-26-2023, 09:22 AM

Header Leaderboard Ad

BLAST possibly returning different results

Announcement

SEQanswers June Challenge Has Begun!

BLAST possibly returning different results

Latest Articles

ad_right_rmr

News