Hi to everyone,
this is my very first post and first of all I'd like to thanks Seqanswers for the possibility offered.
I've submitted the following sequence to BLASTN:
CTTGACAAGCTAGCTTTAGTTTAAAAACTCCAACTGCCAAAGGAATTAAATTTTTCTTAAAGTAGTATTTCTAAAATACAATTTTTTTGAATTAGTAGTA
among the results I received also a single match to the following organism:
Clostridium botulinum Ba4 str. 657 GenBank CP001083.1
so I tried and run BLASTN again specifying the organism in the Organism field of BLASTN.
Surprisingly I did obtain 4 matches now (apart from plasmid). They are highlighted in black as poor results but why did BLASTN provide them now only?
Thanks for any help
-
BLAST possibly returning different results
Last edited by Jona; 08-08-2017, 03:04 AM.
-
Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...09-07-2023, 11:15 PM -
Ribonucleic acid (RNA) represents a range of diverse molecules that play a crucial role in many cellular processes. From serving as a protein template to regulating genes, the complex processes involving RNA make it a focal point of study for many scientists. This article will spotlight various methods scientists have developed to investigate different RNA subtypes and the broader transcriptome.
Whole Transcriptome RNA-seq
Whole transcriptome sequencing...08-31-2023, 11:07 AM