Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • HISAT2: a surprising read shows up in alignment results

    I was spot-checking the output of alignment results from HISAT2 and noticed one read (CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT shown below) that does not exist in my input fastq files. Is this the result of a bug or am I missing anything?

    $ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 409 chr19 14733987 0 76M = 14733987 0 CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT GGGGGGGGCGGGEGG>FGGGGGGBEGGGD@GEGEGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGCBCCC AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:69G6 YT:Z:UP NH:i:2
    $ zcat read1.fq.gz read2.fq.gz|grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
    $ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep HISEQ:287:CCK1AANXX:5:2307:14574:99798
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 137 chr10 33189363 0 76M = 33189363 0 AAATAGTACTGTAAAAAGTGAACTGTTAAAACTAAAGGCACTTAAAACAAGAATGTGACTAGTGTGAAACAAGATG CCCBCGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGEGEG@DGGGEBGGGGGGF>GGEGGGCGGGGGGGG AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:6C69 YT:Z:UP NH:i:2
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 409 chr19 14733987 0 76M = 14733987 0 CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT GGGGGGGGCGGGEGG>FGGGGGGBEGGGD@GEGEGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGCBCCC AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:69G6 YT:Z:UP NH:i:2
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 69 chr10 33189363 0 * = 33189363 0 ATAAACATACAGTGGTCTGTTATGGCACTAACTCCCCGTACTCTGCGTTGGTATCAACGCAGAGTACGGGGAGTTA 33<::BFGGGGGGGGDGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGFEGGGGGGGGGG@GGEGGGGGGGEGGGG YT:Z:UP

    The other two entries in the sam output with read name of HISEQ:287:CCK1AANXX:5:2307:14574:99798 are from my input fastq files as expected (a read pair).

    I appreciate any comments. Thanks!

  • #2
    Here's the answer (thanks to Daehwan from the HISAT2 team):
    CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT is the reverse complement of AAATAGTACTGTAAAAAGTGAACTGTTAAAACTAAAGGCACTTAAAACAAGAATGTGACTAGTGTGAAACAAGATG, which is read 1 of HISEQ:287:CCK1AANXX:5:2307:14574:99798.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Exploring the Dynamics of the Tumor Microenvironment
      by seqadmin




      The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
      07-08-2024, 03:19 PM
    • seqadmin
      Exploring Human Diversity Through Large-Scale Omics
      by seqadmin


      In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
      06-25-2024, 06:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 07-19-2024, 07:20 AM
    0 responses
    34 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-16-2024, 05:49 AM
    0 responses
    46 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-15-2024, 06:53 AM
    0 responses
    56 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-10-2024, 07:30 AM
    0 responses
    43 views
    0 likes
    Last Post seqadmin  
    Working...
    X