Header Leaderboard Ad

Collapse

why i have less than 50% reads surviving in pair after trimming adapters?

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • why i have less than 50% reads surviving in pair after trimming adapters?

    Hi All.

    I'm using a ramdom amplification protocol and for library preparation I'm using Nextera XT. I'm performing seq step with Miseq reagent kit v3 600 cycles but i only use 200 cycles instead of 300 in order to get better quality score.

    After adapters trimmed with Trimmomatic I've got this result:

    TrimmomaticPE: Started with arguments:
    -phred33 -trimlog 12143_trimlog.txt 12143_R1.fastq.gz 12143_R2.fastq.gz 12143_FWP.fq.gz 12143_FWUP.fq.gz 12143_REVP.fq.gz 12143_REVUP.fq.gz ILLUMINACLIP:/home/dell/miniconda3/share/trimmomatic/adapters/NexteraPE-PE.fa:2:30:10
    Multiple cores found: Using 4 threads
    Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
    Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
    Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
    Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
    Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
    ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Read Pairs: 2764988 Both Surviving: 658763 (23.83%) Forward Only Surviving: 2105922 (76.16%) Reverse Only Surviving: 288 (0.01%) Dropped: 15 (0.00%)
    TrimmomaticPE: Completed successfully

    FastQC basic statistics for forward before triimmig
    Encoding Sanger / Illumina 1.9
    Total Sequences 2764988
    Sequences flagged as poor quality 0
    Sequence length 201
    %GC 42

    FastQC basic statistics for forward paired after triimmig
    Encoding Sanger / Illumina 1.9
    Total Sequences 658763
    Sequences flagged as poor quality 0
    Sequence length 1-201
    %GC 41
    Why I have a very low % of both surviving and why a high value for forward only?

    I really appreciate your feedbacks.


    thanks

    Chris
    Last edited by criscruz; 08-05-2018, 09:31 PM.

  • #2
    Originally posted by criscruz View Post
    <CLIP>
    Why I have a very low % of both surviving and why a high value for forward only?

    I really appreciate your feedbacks.


    thanks

    Chris
    This result indicates that your library included a large percentage of fragments with insert size less than or equal to 200bp in length. The way Trimmomatic paired end trimming operates (by default) when it finds the forward and reverse read overlap 100% (i.e. the insert is shorter than the read length) it keeps read 1 and discards read 2. The result is read 1 (forward) surviving but read 2 (reverse) not. When the overlap is only partial or not at all (i.e. insert is > 200bp) both read 1 and read 2 survive.

    Comment


    • #3
      thanks so much kmcarr

      Comment

      Latest Articles

      Collapse

      • seqadmin
        A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
        by seqadmin


        ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

        01-24-2023, 01:19 PM
      • seqadmin
        Introduction to Single-Cell Sequencing
        by seqadmin
        Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

        The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
        ...
        01-09-2023, 03:10 PM

      ad_right_rmr

      Collapse
      Working...
      X