
No announcement yet.


  • Filter
  • Time
  • Show
Clear All
new posts

  • MACS SAMfiles

    I've used MACS to find peaks in a SAM file, and I got a line in the peaks.bed file in SAM with negative start (-98) so I cannot upload the file in UCSC genome browser.
    chrM -98 4052 macs_PEAK_50677 971.81
    Does somebody understand the reason for this output? Is there a bug in MACS when it finds hits the negative strand?

  • #2
    Hi khb,

    What software did you use to produce the alignment? Can you post some of the reads mapping to chrM?



    • #3
      I used bowtie.
      Here is some of the output from bowtie
      HWUSI-EAS1525_0005_FC:4:1:7582:8004#0/1 - chrM 313 CCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAA cgcag_^^^[X_LXV]ggggcfccfX_YZZQdbdb_afffdfcffggggg 0
      HWUSI-EAS1525_0005_FC:4:1:15912:8129#0/1 - chrM 14456 ATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAA afhhhfhhghhhhfhhhhhhgghhhfghghhghhhhhhhhhhhhhhhhgh 0
      HWUSI-EAS1525_0005_FC:4:1:13895:8331#0/1 + chrM 3185 ATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAA ggggcgggggffdcffdfffgggggggggggggggffgggfdafffeccd 0
      HWUSI-EAS1525_0005_FC:4:1:10583:8537#0/1 - chrM 12329 TAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTAACTTCC gfgggggggggdgggeffefaffafadde\_d^eefffafffffcebbee 0 6:G>A
      HWUSI-EAS1525_0005_FC:4:1:14677:8853#0/1 - chrM 11331 CCAACAACTTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATA ]adcffeffcffcfffcddffcfcdedeee[afcffcffcffdcffffcf 0
      HWUSI-EAS1525_0005_FC:4:1:19550:9039#0/1 + chrM 3344 TTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGC hhhhhhhhhhhghghehgghhhhhghfhghhg_hhfcfefgdfffcfdcc 0
      HWUSI-EAS1525_0005_FC:4:1:5655:9204#0/1 + chrM 13011 CCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCC hhhhhhghhhhhhhhhhhhghghhhgahgh_ffcchhhhfhchgghhh`h 0
      HWUSI-EAS1525_0005_FC:4:1:3891:9219#0/1 - chrM 12759 CATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGAT ccffdagggggddgegffgggggggggffgffffdgfecfcggggggggg 0
      HWUSI-EAS1525_0005_FC:4:1:10936:9386#0/1 - chrM 511 CCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCC c[^Y^T[T[Wb]bTbf[feeb`d_ecffdb]deeefff_fafffff`eff 0
      HWUSI-EAS1525_0005_FC:4:1:5529:9413#0/1 + chrM 595 CCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATA hhhhhhghhfhhhghhhhhhhhhhhhhhhhghhhfghhhhhhhhhhhhfh 0
      HWUSI-EAS1525_0005_FC:4:1:10410:9859#0/1 + chrM 10090 CCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTC gggfgfcffafffdff_fcfffddffffffggfggfa]fcfefcfaffec 0

      Last edited by khb; 12-19-2010, 10:25 PM.

