Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • sklages
    replied
    Originally posted by GraemeFox View Post
    In the midconfig.parse file, does anybody know what the default values are for the number of mismatches allowed in each MID?
    For standard titanium, have a look at the number just before the ';', e.g. 2

    Code:
    TITANIUM
    {
            mid = "1", "ACGAGTGCGT", 2;
            mid = "2", "ACGCTCGACA", 2;
    }
    For RapidLibs have a look at the number in the middle, e.g. 1

    Code:
    RLMIDs
    {
            mid = "RL1",   "ACACGACGACT", 1, "AGTCGTGGTGT";
            mid = "RL2",   "ACACGTAGTAT", 1, "ATACTAGGTGT";
    }
    Also have a look at the docs, "4.7.2 The MIDConfig.parse File".

    Sven

    Leave a comment:


  • GraemeFox
    replied
    In the midconfig.parse file, does anybody know what the default values are for the number of mismatches allowed in each MID?

    Leave a comment:


  • prisnirath
    replied
    thank you

    Leave a comment:


  • sklages
    replied
    Originally posted by prisnirath View Post
    right! bt i need my final MID trimmed file in sff format...
    I haven't yet explored sffinfo but sff2fastq appears to be extracting fastq files from sff files.
    -> you get SFF (sfffile outputs just SFF)

    If you don't need another format, fine :-) You now have all you need ..

    Leave a comment:


  • prisnirath
    replied
    right! bt i need my final MID trimmed file in sff format...
    I haven't yet explored sffinfo but sff2fastq appears to be extracting fastq files from sff files.

    Leave a comment:


  • sklages
    replied
    Originally posted by prisnirath View Post
    One more question Sven..

    After executing this::

    I got some MID sorted SFF files.
    Next step is trimming off the MIDs.
    when I am trying to do that on a single line command.... it shows error!
    'sfffile' splits the input SFFs according to their MIDs. It also shifts the trimpoints in the sff file accordingly. So if you use e.g. 'sffinfo' to extract the sequences (or sff2fastq), then it will skip the MID sequence. Offsets are shifted from 5 (key sequence) to something around 14 ...

    There's no need to extra trim your MIDs ... :-)

    Leave a comment:


  • prisnirath
    replied
    what is a typical format of trim file?? I want to trim off my MIDs

    Leave a comment:


  • prisnirath
    replied
    One more question Sven..

    After executing this::
    sfffile -s GSMIDs -mcf File2.txt -o reg1 GGDP4G001.sff >MIDyieldR1.txt
    I got some MID sorted SFF files.
    Next step is trimming off the MIDs.
    when I am trying to do that on a single line command.... it shows error!

    sfffile -s GSMIDs -mcf File2.txt -t -o reg1 GGDP4G001.sff >MIDyieldR1.txt
    Error: Unable to open accno/trim file: -o

    Leave a comment:


  • sklages
    replied
    Originally posted by prisnirath View Post
    this is the format of my txt MID file
    Go for something like this:

    Code:
    MyMIDs
    {
        mid = "MID01", ACGAGTGCGTGTAGCGCGACGGCCAGT, 2;
        mid = "MID02", ACGAGTGCGTCAGGGCGCAGCGATGAC, 2;
        mid = "MID03", ACGCTCGACAGTAGCGCGACGGCCAGT, 2;
        mid = "MID04", ACGCTCGACACAGGGCGCAGCGATGAC, 2;
        mid = "MID05", AGACGCACTCGTAGCGCGACGGCCAGT, 2;
        mid = "MID05", AGACGCACTCCAGGGCGCAGCGATGAC, 2;
        mid = "MID06", AGCACTGTAGGTAGCGCGACGGCCAGT, 2;
        mid = "MID07", AGCACTGTAGCAGGGCGCAGCGATGAC, 2;
    }
    .. change the names and/or mismatches to whatever is approbiate ..

    hth,
    Sven

    Leave a comment:


  • prisnirath
    replied
    thank you!

    Leave a comment:


  • prisnirath
    replied
    ahh!!! right!! It worked!!

    Leave a comment:


  • sklages
    replied
    Originally posted by prisnirath View Post
    i have got my SFF files...true!!
    I got a MID file in csv format.
    And I have parsed it to a tab-delimited file.
    My question is while using ::
    sfffile -s SPC_MIDs -mcf MyMIDfile.parse MY_SFF_FILE.sff

    MyMIDfile.parse :: MID file (right??)

    ...what file format shoud I be using for parsing it to its acceptable format?

    I took suggestions from the thread http://seqanswers.com/forums/showthread.php?t=10825
    and I am getting error!!
    sfffile -s Y -mcf file2.txt -o reg1 GGDP4G001.sff >MIDyieldR1.txt
    Error: Invalid file format 2: file2.txt
    Have you read my post? I have described the format you should use for sfffile to split SFFs according to their MIDs ...

    Just another ... the output of sfffile is a new SFF; no need to redirect (to a text file) ..

    hth,
    Sven
    Last edited by sklages; 05-26-2011, 04:37 AM. Reason: typo

    Leave a comment:


  • prisnirath
    replied
    ACGAGTGCGTGTAGCGCGACGGCCAGT
    ACGAGTGCGTCAGGGCGCAGCGATGAC
    ACGCTCGACAGTAGCGCGACGGCCAGT
    ACGCTCGACACAGGGCGCAGCGATGAC
    AGACGCACTCGTAGCGCGACGGCCAGT
    AGACGCACTCCAGGGCGCAGCGATGAC
    AGCACTGTAGGTAGCGCGACGGCCAGT
    AGCACTGTAGCAGGGCGCAGCGATGAC
    ;
    ;
    ;
    this is the format of my txt MID file

    Leave a comment:


  • prisnirath
    replied
    i have got my SFF files...true!!
    I got a MID file in csv format.
    And I have parsed it to a tab-delimited file.
    My question is while using ::
    sfffile -s SPC_MIDs -mcf MyMIDfile.parse MY_SFF_FILE.sff

    MyMIDfile.parse :: MID file (right??)

    ...what file format shoud I be using for parsing it to its acceptable format?

    I took suggestions from the thread http://seqanswers.com/forums/showthread.php?t=10825
    and I am getting error!!
    sfffile -s Y -mcf file2.txt -o reg1 GGDP4G001.sff >MIDyieldR1.txt
    Error: Invalid file format 2: file2.txt

    Leave a comment:


  • sklages
    replied
    Originally posted by prisnirath View Post
    Thank you!!
    I understand it now!
    But still a little confused...
    I have got my MID files in CSV format and I have converted this file into txt, tab delimited and fasta file.
    Which format should I be using here?
    Now, I am confused :-)

    You should have your data in SFF files, your MIDs in roche conform "parse" format, e.g.
    Code:
    CUSTOM_MULTIPLEX
    {
        mid = "MID4000", "ACACGT", 0;
        mid = "MID4001", "ACGTAC", 0;
        mid = "MID4002", "ACTGCA", 0;
        mid = "MID4003", "AGAGTC", 0;
    }
    where '0' stands for the allowed number of mismatches for a MID to be still valid.

    If you use "Rapid Libraries" you might want to check 3' ends as well,
    Code:
    RLMIDs
    {
        mid = "RL1",   "ACACGACGACT", 1, "AGTCGTGGTGT";
        mid = "RL2",   "ACACGTAGTAT", 1, "ATACTAGGTGT";
        mid = "RL3",   "ACACTACTCGT", 1, "ACGAGTGGTGT";
        mid = "RL4",   "ACGACACGTAT", 1, "ATACGTGGCGT";
    }
    Again, the number stands for allowed mismatches in MID recognition.
    The second sequence in this format has no influence on splitting, it just gets trimmed (if found). Splitting is exclusively done on MIDs present at the 5' end.

    hth,
    Sven

    Leave a comment:

Latest Articles

Collapse

  • seqadmin
    Advanced Tools Transforming the Field of Cytogenomics
    by seqadmin


    At the intersection of cytogenetics and genomics lies the exciting field of cytogenomics. It focuses on studying chromosomes at a molecular scale, involving techniques that analyze either the whole genome or particular DNA sequences to examine variations in structure and behavior at the chromosomal or subchromosomal level. By integrating cytogenetic techniques with genomic analysis, researchers can effectively investigate chromosomal abnormalities related to diseases, particularly...
    09-26-2023, 06:26 AM
  • seqadmin
    How RNA-Seq is Transforming Cancer Studies
    by seqadmin



    Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...
    09-07-2023, 11:15 PM
  • seqadmin
    Methods for Investigating the Transcriptome
    by seqadmin




    Ribonucleic acid (RNA) represents a range of diverse molecules that play a crucial role in many cellular processes. From serving as a protein template to regulating genes, the complex processes involving RNA make it a focal point of study for many scientists. This article will spotlight various methods scientists have developed to investigate different RNA subtypes and the broader transcriptome.

    Whole Transcriptome RNA-seq
    Whole transcriptome sequencing...
    08-31-2023, 11:07 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 06:57 AM
0 responses
10 views
0 likes
Last Post seqadmin  
Started by seqadmin, 09-26-2023, 07:53 AM
0 responses
10 views
0 likes
Last Post seqadmin  
Started by seqadmin, 09-25-2023, 07:42 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, 09-22-2023, 09:05 AM
0 responses
45 views
0 likes
Last Post seqadmin  
Working...
X