Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • dpryan
    replied
    Unique alignments in bowtie2 have MAPQ>=2, so you can just filter the results by that.

    Leave a comment:


  • emp
    replied
    hello Wallysb01,

    after searching a lot for Bowtie2 to get uniquely matched reads, I think bowtie 1 is the only way out.

    thanku for the same.

    Leave a comment:


  • Wallysb01
    replied
    Originally posted by emp View Post
    hello all,
    I have Illumina data, which I mapped through Bowtie2 and got a sam file.

    Now I need to extract the reads which are being shown uniquely one time.

    Kindly guide if something could be done for that.

    I have tried a bit of commands for the above, but failed to get those reads separated.

    Kindly guide ASAP.
    How about just use bowtie with the -m 1 option set?

    Leave a comment:


  • emp
    replied
    hello all,
    I have Illumina data, which I mapped through Bowtie2 and got a sam file.

    Now I need to extract the reads which are being shown uniquely one time.

    Kindly guide if something could be done for that.

    I have tried a bit of commands for the above, but failed to get those reads separated.

    Kindly guide ASAP.

    Leave a comment:


  • gfmgfm
    replied
    I am not an expert, but don't think you can extract this from the _export file. I think XT:A:U is specific to bwa (maybe also other aligners?).

    Maybe you would like to use the _sorted file from the Illumina pipeline:
    the desciption of the _sorted file- from CASAVA 1.7 manual p. 73:
    This output file is similar to s_N_export.txt, except it contains
    only entries for reads which pass purity filtering and have a
    unique alignment in the reference. These are sorted by order
    of their alignment position, which is meant to facilitate the
    extraction of ranges of reads for purposes of visualization or
    SNP calling.
    These files are only produced if the flag WITH_SORTED is
    used."

    Alternatively, you can take your reads and align them with bwa (or with other aligner that gives you this info).

    Leave a comment:


  • seq_GA
    replied
    Hi,
    I am also looking for such solution. But in my bam file, I don't see any
    Code:
    XT:A:U
    instead its a SOLEXA single read where I have converted export to sam format as below.



    Code:
    test_1:8:69:19633:9434       0       chr10   5423197 4       45M     *       0       0       CACACAACCCCCACACCAAACACACACCCCCCACACACAACAAAC      0.2B90+)*=@8@################################   XD:Z:6C11C15G4CACT2     SM:i:4
    test_1:8:56:11474:20981      0       chr10   7323903 6       45M     *       0       0       ATCAAGCGATCCTCCCACCTCATCCCCCTAAGTACCTGTGACTAA      757@54;3;1@@@@@22@###########################   XD:Z:22G11G3G5C SM:i:6
    Any generic way of picking unique hits from sam file? Thanks.

    Leave a comment:


  • gfmgfm
    replied
    Thanks a lot!

    Leave a comment:


  • drio
    replied
    Take a look to this thread.

    I'd suggest you follow bwa's FAQ advice and rely more in the MAPQ. Still, if you want to
    filter uniquely mapped:

    Code:
    $ samtools view bwa.bam | grep "XT:A:U"

    Leave a comment:


  • gfmgfm
    started a topic how to extract unique hits from a sam file

    how to extract unique hits from a sam file

    I aligned reads with bwa and I want to get a set of the reads that mapped uniquely to the genome.
    I understood from samtools faq that they suggest to look at 'reliable' rather than `unique' by :

    samtools view -bq 1 aln.bam > aln-reliable.bam

    Download SAM tools for free. SAM (Sequence Alignment/Map) is a flexible generic format for storing nucleotide sequence alignment. SAMtools provide efficient utilities on manipulating alignments in the SAM format.


    However, I am interested to get the subset of the uniquely mapped reads, in order to do some calculations on it.

    How can one do it?

Latest Articles

Collapse

  • seqadmin
    The Impact of AI in Genomic Medicine
    by seqadmin



    Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
    02-26-2024, 02:07 PM
  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-28-2024, 06:12 AM
0 responses
30 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-23-2024, 04:11 PM
0 responses
74 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
87 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
71 views
0 likes
Last Post seqadmin  
Working...
X