Header Leaderboard Ad


how to extract unique hits from a sam file



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • dpryan
    Unique alignments in bowtie2 have MAPQ>=2, so you can just filter the results by that.

    Leave a comment:

  • emp
    hello Wallysb01,

    after searching a lot for Bowtie2 to get uniquely matched reads, I think bowtie 1 is the only way out.

    thanku for the same.

    Leave a comment:

  • Wallysb01
    Originally posted by emp View Post
    hello all,
    I have Illumina data, which I mapped through Bowtie2 and got a sam file.

    Now I need to extract the reads which are being shown uniquely one time.

    Kindly guide if something could be done for that.

    I have tried a bit of commands for the above, but failed to get those reads separated.

    Kindly guide ASAP.
    How about just use bowtie with the -m 1 option set?

    Leave a comment:

  • emp
    hello all,
    I have Illumina data, which I mapped through Bowtie2 and got a sam file.

    Now I need to extract the reads which are being shown uniquely one time.

    Kindly guide if something could be done for that.

    I have tried a bit of commands for the above, but failed to get those reads separated.

    Kindly guide ASAP.

    Leave a comment:

  • gfmgfm
    I am not an expert, but don't think you can extract this from the _export file. I think XT:A:U is specific to bwa (maybe also other aligners?).

    Maybe you would like to use the _sorted file from the Illumina pipeline:
    the desciption of the _sorted file- from CASAVA 1.7 manual p. 73:
    This output file is similar to s_N_export.txt, except it contains
    only entries for reads which pass purity filtering and have a
    unique alignment in the reference. These are sorted by order
    of their alignment position, which is meant to facilitate the
    extraction of ranges of reads for purposes of visualization or
    SNP calling.
    These files are only produced if the flag WITH_SORTED is

    Alternatively, you can take your reads and align them with bwa (or with other aligner that gives you this info).

    Leave a comment:

  • seq_GA
    I am also looking for such solution. But in my bam file, I don't see any
    instead its a SOLEXA single read where I have converted export to sam format as below.

    test_1:8:69:19633:9434       0       chr10   5423197 4       45M     *       0       0       CACACAACCCCCACACCAAACACACACCCCCCACACACAACAAAC      0.2B90+)*[email protected]@################################   XD:Z:6C11C15G4CACT2     SM:i:4
    test_1:8:56:11474:20981      0       chr10   7323903 6       45M     *       0       0       ATCAAGCGATCCTCCCACCTCATCCCCCTAAGTACCTGTGACTAA      [email protected];3;[email protected]@@@@[email protected]###########################   XD:Z:22G11G3G5C SM:i:6
    Any generic way of picking unique hits from sam file? Thanks.

    Leave a comment:

  • gfmgfm
    Thanks a lot!

    Leave a comment:

  • drio
    Take a look to this thread.

    I'd suggest you follow bwa's FAQ advice and rely more in the MAPQ. Still, if you want to
    filter uniquely mapped:

    $ samtools view bwa.bam | grep "XT:A:U"

    Leave a comment:

  • gfmgfm
    started a topic how to extract unique hits from a sam file

    how to extract unique hits from a sam file

    I aligned reads with bwa and I want to get a set of the reads that mapped uniquely to the genome.
    I understood from samtools faq that they suggest to look at 'reliable' rather than `unique' by :

    samtools view -bq 1 aln.bam > aln-reliable.bam


    However, I am interested to get the subset of the uniquely mapped reads, in order to do some calculations on it.

    How can one do it?

Latest Articles


  • seqadmin
    A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
    by seqadmin

    ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

    01-24-2023, 01:19 PM
  • seqadmin
    Introduction to Single-Cell Sequencing
    by seqadmin
    Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

    The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
    01-09-2023, 03:10 PM

