Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Cufflinks error

    When running cufflinks I get the following error:

    $ cufflinks -G annotation.gtf ./s_1/accepted_hits.bam
    cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
    Error: sort order of reads in BAMs must be the same

    I am using TopHat v1.1.4 to create the BAMs with bowtie indexes.
    The cufflinks version is cufflinks v0.9.3.

    Based on previous posts I tried reverting from the BAM to SAM, but got the same result.

    Any ideas? Thanks!

  • #2
    Same here

    I've run into the same issue...

    Comment


    • #3
      Me too

      I've had this error as well. I emailed the help email address and they said it's a rare issue with the software where the contig names have hash collisions. The problem should be fixed when they release Cufflinks v1.0.

      Comment


      • #4
        cufflinks version 1.0

        Thanks for the information. Did they mention when they would release that version?

        Comment


        • #5
          I had exactly the same problem; sorting the BAM file didn't help.

          Comment


          • #6
            Tech support was able to find the cause of my error in my SAM file. In the header section I had some colons as part of my contig names that messed up Cufflinks. By removing the colons in the header and throughout the file I stopped getting this error.
            Originally I had:
            @SQ SN:chromosome:AGPv2:1:1:301354135:1 LN:301354135
            and this changed to:
            @SQ SN:chromosome1 LN:301354135

            Hope this helps.
            Last edited by ameyer; 03-01-2011, 07:45 AM.

            Comment


            • #7
              Interesting. I checked my SAM files, and the @SQ lines only have two colons:

              @HD VN:1.0 SO:sorted
              @SQ SN:EG:bd_7x3 LN:450
              @SQ SN:EG:bd_6x3 LN:450
              @SQ SN:EG:bd_36x35 LN:554
              @SQ SN:EG:bd_55x36 LN:808
              @SQ SN:EG:bd_54x36 LN:1351
              @SQ SN:EG:bd_16x14 LN:1992
              @SQ SN:EG:bd_53x36 LN:2027
              @SQ SN:EG:bd_52x36 LN:2040
              @SQ SN:EG:bd_51x36 LN:2113
              @SQ SN:EG:bd_37x35 LN:2489
              . . .

              From your experience, is that enough to trigger the error?

              What about the reads references after that? Mine do contain a lot of colons. Did you have to modify them to? E.g.,

              @PG ID:TopHat VN:1.2.0 CL:../Applications/tophat/1.2.0/tophat -o ./2_run_TopHat/JV-
              A_on_Phatr-ENSEMBL-unmasked --num-threads 4 -G ../Data/Genome/ENSEMBL/Phaeodactylum_tricornutum.Phat
              r2.61.gtf ./1_create_Bowtie_index/Phatr-ENSEMBL-unmasked ../Data/Expression/2011.02.02/JV-A.fastq
              SNPSTER7_0744:2:33:16520:18860#0 16 EG:bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
              hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
              SNPSTER7_0744:2:58:18789:10460#0 16 EG:bd_6x3 6 255 54M * 0 0 GGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTCG [ffffc_ccfffWcZ\Z\ZYT_NYcfaaf
              ffcfccff]fffccffffafffafc NM:i:0 NH:i:1
              . . .

              Comment


              • #8
                The only colons that are allowed in the @SQ lines are the ones directly after SN and LN so the one you have between EG and bd would have to be removed. It would also have to be removed in all the read references so that the the names match each other.
                So for example you would have:
                @SQ SN:bd_6x3 LN:450
                and:
                SNPSTER7_0744:2:33:16520:18860#0 16 bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
                hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1

                Comment


                • #9
                  It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                  Aurelien
                  Attached Files

                  Comment


                  • #10
                    Originally posted by Aurelien Mazurie View Post
                    It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                    Aurelien
                    Your script just saved my bacon. Thank you SO much for this!!!

                    Comment


                    • #11
                      COLONS in the fasta and GFF!!!!!

                      Comment

                      Latest Articles

                      Collapse

                      • seqadmin
                        Current Approaches to Protein Sequencing
                        by seqadmin


                        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                        04-04-2024, 04:25 PM
                      • seqadmin
                        Strategies for Sequencing Challenging Samples
                        by seqadmin


                        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                        03-22-2024, 06:39 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by seqadmin, 04-11-2024, 12:08 PM
                      0 responses
                      32 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 04-10-2024, 10:19 PM
                      0 responses
                      37 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 04-10-2024, 09:21 AM
                      0 responses
                      31 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 04-04-2024, 09:00 AM
                      0 responses
                      53 views
                      0 likes
                      Last Post seqadmin  
                      Working...
                      X