Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • zack80.liu
    replied
    Thanks for the reply.

    Leave a comment:


  • HSJD19
    replied
    Might I also suggest reading this thread
    New here? Stop in and introduce yourself. Where you are, what you work on, etc.

    Leave a comment:


  • HSJD19
    replied
    Format

    This is an export file.
    HWUSI-EAS1744181116518700 1 - Unique Read Identifier
    CAACAACTCACCTGCCGAACCAACTAGCTCTGACAACCGATGTCAATCGAACATCGGACGCAATGGAGAACAACG - Sequence

    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB - Quality Score in Illumina Platform

    N - The Y or N in the last column is from the Illumina CHASITY filter. Y means yes it pass N means no . I don't think you should use the N sequences.

    Leave a comment:


  • zack80.liu
    started a topic What is this format? How to run bowtie on it.

    What is this format? How to run bowtie on it.

    I am a newbie to NGS. Please help.

    I have the following file (I was told that it is a export file of illumina)

    HWUSI-EAS1744 1 8 1 1165 18707 0 1 CAACAACTCACCTGCCGAACCAACTAGCTCTGACAACCGATGTCAATCGAACATCGGACGCAATGGAGAACAACG BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB NM N
    HWUSI-EAS1744 1 8 1 1166 9747 0 1 GGCAAGCCGGATCCGTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCGG bbbbbbabbbbbbbbbbbbbbbbbabbbbb`_bbbbbbbbbbbbbbbbbba`bb__bbb[W]`^^BBBBBBBBBB 0:0:1 Y

    Q1: How do I convert this to fastaq format?
    Q2: Is bbbbbbabbbbbbbbbbbbbbbbbabbbbb`_bbbbbbbbbbbbbbbbbba`bb__bbb[W]`^^BBBBBBBBBB the quality score?
    Q3: How to run bowtie on this file.

    Thanks.

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-21-2024, 07:49 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-20-2024, 07:23 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-17-2024, 06:54 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
25 views
0 likes
Last Post seqadmin  
Working...
X