Announcement

Collapse

Welcome to the New Seqanswers!

Welcome to the new Seqanswers! We'd love your feedback, please post any you have to this topic: New Seqanswers Feedback.
See more
See less

Question about pthred quality

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Question about pthred quality

    Hi,
    i have a question about phred quality values in fastq format(Sanger).
    I know that phred quality = character_code - 33 and that error probability is 10^(-phred quality/10).
    So for " character(code=34), that is always appears in front of N character in sequence, quality is ~0.8 that is closest code for 0.75 error probability (all bases are equaly probable).
    But what about ! character (code=33)? error probability = 1
    Is it means that corresponding base in sequence wrong with probability=1 (at least >0.8) and other 3 bases equaly probable?
    For example:
    @SRR00XXXX
    TAAGTTTTCTTATTTATATAACTACATATTTTTTTA
    +SRR00XXXX
    I%0IIIII,I"$EI(%[email protected]?2!&(02*/&",&/-'%

    C in 22 position has quality ! (i.e in this position can be A or T or G but not C ?)
    Last edited by -daf-; 02-05-2009, 03:50 AM. Reason: misprint
Working...
X