Hi,
i have a question about phred quality values in fastq format(Sanger).
I know that phred quality = character_code - 33 and that error probability is 10^(-phred quality/10).
So for " character(code=34), that is always appears in front of N character in sequence, quality is ~0.8 that is closest code for 0.75 error probability (all bases are equaly probable).
But what about ! character (code=33)? error probability = 1
Is it means that corresponding base in sequence wrong with probability=1 (at least >0.8) and other 3 bases equaly probable?
For example:
@SRR00XXXX
TAAGTTTTCTTATTTATATAACTACATATTTTTTTA
+SRR00XXXX
I%0IIIII,I"$EI(%[email protected]?2!&(02*/&",&/-'%

C in 22 position has quality ! (i.e in this position can be A or T or G but not C ?)