Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • najoshi
    started a topic snpeff effect annotation confusion

    snpeff effect annotation confusion

    So I am trying to figure out why this particular complex variant was annotated with an effect of "start_lost" when I don't see any evidence of the start codon being changed. Here is the full vcf line:

    Code:
    chr1	20717668	.	ACGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAA	GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC	566.598	.	AB=0.347826;ABP=12.2627;AC=5;AF=0.5;AN=10;AO=16;CIGAR=1X57M1X;DP=46;DPB=46.1525;DPRA=0;EPP=5.18177;EPPR=4.16842;GTI=0;LEN=59;MEANALT=1;MQM=60;MQMR=60;NS=5;NUMALT=1;ODDS=5.38955;PAIRED=0.5625;PAIREDR=0.466667;PAO=9;PQA=333;PQR=0;PRO=0;QA=586;QR=1103;RO=30;RPL=13;RPP=16.582;RPPR=31.9633;RPR=3;RUN=1;SAF=7;SAP=3.55317;SAR=9;SRF=8;SRP=17.1973;SRR=22;TYPE=complex;ANN=GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3958|1/3087|1/1028||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001287212.2|protein_coding|1/15|c.-447_-389delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2098|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103161.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541459.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541460.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541462.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541461.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103160.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|intron_variant|MODIFIER|LOC107985528|LOC107985528|transcript|unknown_transcript_1|protein_coding|987/1510|c.167449+904178_167449+904236delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||WARNING_TRANSCRIPT_MULTIPLE_STOP_CODONS;LOF=(KIF17|KIF17|3|0.67)	GT:DP:AD:RO:QR:AO:QA:GL	0/1:4:3,1:3:111:1:37:-2.49371,0,-9.14896	0/1:9:6,3:6:221:3:109:-13.5154,0,-16.9355	0/1:11:6,5:6:223:5:182:-16.4518,0,-16.8162	0/1:12:8,4:8:294:4:149:-22.2684,0,-21.995	0/1:10:7,3:7:254:3:109:-13.2144,0,-19.5986
    The first annotation looks like this:

    Code:
    GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||
    For some reason it is calling it a deletion & insertion instead of just two separate SNPs. Looking at the two sequences:

    Code:
    TTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGT
    GTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC
    you can see that all of the bases are the same except for the first and last bases. The start codon is in the middle, i.e. this variant crosses the 5'UTR to exon 1 boundary. However, the start codon does not change, so why is it being annotated as a "start_lost"?

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
24 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
58 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
45 views
0 likes
Last Post seqadmin  
Working...
X