Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • snpeff effect annotation confusion

    So I am trying to figure out why this particular complex variant was annotated with an effect of "start_lost" when I don't see any evidence of the start codon being changed. Here is the full vcf line:

    Code:
    chr1	20717668	.	ACGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAA	GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC	566.598	.	AB=0.347826;ABP=12.2627;AC=5;AF=0.5;AN=10;AO=16;CIGAR=1X57M1X;DP=46;DPB=46.1525;DPRA=0;EPP=5.18177;EPPR=4.16842;GTI=0;LEN=59;MEANALT=1;MQM=60;MQMR=60;NS=5;NUMALT=1;ODDS=5.38955;PAIRED=0.5625;PAIREDR=0.466667;PAO=9;PQA=333;PQR=0;PRO=0;QA=586;QR=1103;RO=30;RPL=13;RPP=16.582;RPPR=31.9633;RPR=3;RUN=1;SAF=7;SAP=3.55317;SAR=9;SRF=8;SRP=17.1973;SRR=22;TYPE=complex;ANN=GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3958|1/3087|1/1028||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001287212.2|protein_coding|1/15|c.-447_-389delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2098|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103161.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541459.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541460.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541462.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541461.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103160.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|intron_variant|MODIFIER|LOC107985528|LOC107985528|transcript|unknown_transcript_1|protein_coding|987/1510|c.167449+904178_167449+904236delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||WARNING_TRANSCRIPT_MULTIPLE_STOP_CODONS;LOF=(KIF17|KIF17|3|0.67)	GT:DP:AD:RO:QR:AO:QA:GL	0/1:4:3,1:3:111:1:37:-2.49371,0,-9.14896	0/1:9:6,3:6:221:3:109:-13.5154,0,-16.9355	0/1:11:6,5:6:223:5:182:-16.4518,0,-16.8162	0/1:12:8,4:8:294:4:149:-22.2684,0,-21.995	0/1:10:7,3:7:254:3:109:-13.2144,0,-19.5986
    The first annotation looks like this:

    Code:
    GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||
    For some reason it is calling it a deletion & insertion instead of just two separate SNPs. Looking at the two sequences:

    Code:
    TTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGT
    GTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC
    you can see that all of the bases are the same except for the first and last bases. The start codon is in the middle, i.e. this variant crosses the 5'UTR to exon 1 boundary. However, the start codon does not change, so why is it being annotated as a "start_lost"?

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 01:32 PM
0 responses
6 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
198 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
220 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
230 views
0 likes
Last Post seqadmin  
Working...
X