Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Pol2021
    started a topic Split read based on conserved sequence repeat

    Split read based on conserved sequence repeat

    I have reads that contain repeats of 10 nt (conserved sequence is known). I want to split the reads into subunits, using the 10 nt as "marker" to know where to split.

    As example (conserved sequence is cccgggttta):
    >
    acagtacccgggtttaatcgatcgatcgtacccgggtttagtacgtacgatcgtcccgggtttatgctgtcgtc

    To get:
    >
    acagtacccgggttta
    >
    atcgatcgatcgtacccgggttta

    >
    gtacgtacgatcgtcccgggttta

    >
    tgctgtcgtc

    Help is appreciated, thank you
    Last edited by Pol2021; 10-21-2021, 09:33 PM.

Latest Articles

Collapse

  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 02-23-2024, 04:11 PM
1 response
22 views
0 likes
Last Post kim897
by kim897
 
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
39 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
26 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
58 views
0 likes
Last Post seqadmin  
Working...
X