Header Leaderboard Ad

Collapse

Adapter sequences

Collapse

Announcement

Collapse

SEQanswers June Challenge Has Begun!

The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!

For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)
See more
See less
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adapter sequences

    I'm looking for the sequences of both the 454 FLX and the Titanium library adapters. I'd also be interested to know the adapter sequences of any of the other platforms.

    Thanks!

  • #2
    I'd also like to know the adaptor sequences.

    Comment


    • #3
      --> http://seqanswers.com/forums/showthread.php?t=4819

      Originally posted by AKroxy View Post
      Here is the info I got from the Roche rep when I asked for the RAPID adaptor sequences so I could design PCR primers.

      The adaptors are double stranded. The sequences TCAG at 3' end of each long adaptor strand are the general Ti shotgun key sequences. The key sequence is different with Rapid Library. The following figure will help in explaining better. You can order the Primers below to check your library.

      emPCR Primer A 5' CCATCTCATCCCTGCGTGTC 3'
      TI A Adaptor 5' CCATCTCATCCCTGCGTGTCTCCGACTCAG 3'
      3' AGAGGCTGAGTC 5'

      emPCR Primer B 5' CCTATCCCCTGTGTGCCTTG 3'
      TI B Adaptor 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3'
      3' ACCGTCAGAGTC 5'

      Comment

      Latest Articles

      Collapse

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Yesterday, 01:08 PM
      0 responses
      6 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 06-01-2023, 08:56 PM
      0 responses
      12 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 06-01-2023, 07:33 AM
      0 responses
      145 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-31-2023, 07:50 AM
      0 responses
      182 views
      0 likes
      Last Post seqadmin  
      Working...
      X