Header Leaderboard Ad
Collapse
trimming BGI adapters
Collapse
Announcement
Collapse
No announcement yet.
X
-
Yes, you are wrong, these are the index sequences, they are in the middle of the adapter. You should use the sequences described by Rnasoup that are abutting the inserts and that should be used for trimming.
Leave a comment:
-
Originally posted by Rnasoup View PostProbably is a bit late for you, but I hope this may help other people. I struggled to find out the sequences to trim adapters from BGI/MGI sequencing data. At the end, I found a pdf with the oligos used for library prep
Normally I use grep to inspect the adapters, but with BGI/MGI it was confusing because I found that there are often mutations in the adapters (I rarely see it when looking Illumina data).
In short, for paired-end, this cutadapt command found adapters in around 10% of the read pairs in this dataset.
Code:cutadapt -a AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA -A AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG
....etc....i7_Index_ID i7index配列 i5_Index_ID i5index配列 DNA Index i7ID i7Seq i5ID i5Seq SG-003 M5041/M7091 M7091 CAATCGTT M5041 CTGCGGAT SG-015 M5041/M7092 M7092 AGCCATAC M5041 CTGCGGAT
So, I used those sequence as adapter trimming. Am I wrong?
Leave a comment:
-
Hi Rnasoup,
Thanks for your reply. What I meant is the data quality in terms of reported phred score vs observed phred score, substitution/indel error rate, problematic region for variant calling etc. Some metrics similar to this thread on a new sequencer.
Cheers
Melissa
Leave a comment:
-
Thanks Melissa,
I am not sure which data quality you mean. Anyway, I don´t have much experience with MGI sequencing, I have just had to dig into it to analyze the GEO dataset that I mentioned in my post, so all I had was the fastq raw data. I guess you can run any software to extract quality information from the fastq files, like Picard tools.
Good luck
Leave a comment:
-
Hi,
Thanks Rnasoup for sharing the link to the sequencing adapter. I tried to find it but nothing showed up in google.
I hope jgroh resolved the adapter issue. It does look quite strange.
By the way, how do you find the data quality of MGI sequencer in terms of error rate etc?
Thanks
MelissaLast edited by Melissa; 03-27-2020, 02:29 AM.
Leave a comment:
-
Probably is a bit late for you, but I hope this may help other people. I struggled to find out the sequences to trim adapters from BGI/MGI sequencing data. At the end, I found a pdf with the oligos used for library prep
Normally I use grep to inspect the adapters, but with BGI/MGI it was confusing because I found that there are often mutations in the adapters (I rarely see it when looking Illumina data).
In short, for paired-end, this cutadapt command found adapters in around 10% of the read pairs in this dataset.
Code:cutadapt -a AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA -A AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG
Leave a comment:
-
trimming BGI adapters
Hello,
I have paired-end 100bp reads generated from BGI-seq 500. The sequencing center did some adapter removal trimming before delivering the data but there appears to be a fraction of reads which still have putative adapter sequences. I am making this judgement based on the presence of 'overrepresented kmers' at the start and ends of both forward and reverse reads seen in the output of FastQC. I've included an image of this module output for one particular sample as an attachment.
The overrepresented kmer at the 3' end match the beginning of the 3' adapter sequence, which makes sense, and I assume this is due to cases where the insert size is less than the read length, so the reads sequence into the adapter on the other side of the genomic fragment.
What is confusing me is that the overrepresented kmers at the 5' end of reads contain what looks like partial sequence of the 5' adapter sequence, but degraded at the 3' end, which I wouldn't expect, and also with one base pair position variable. I wouldn't necessarily expect sequencing error either as the quality scores are generally very high at the start of the reads.
Here is the 5' adapter sequence provide by the sequencing center:
5' adapter AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG. The underlined part is what is appearing in fragments at the start of reads, and the position in bold is variable among these. Libraries were prepared by the sequencing center, and the sequencing technology is still a bit unclear to me, so I'm not sure whether this is a true artefact. Has anyone seen this patterns in the data from BGI before? I may just leave the data as is and proceed with mapping, as these reads are a small fraction overall, but I'm trying to understand what might be going on....
Thanks
Latest Articles
Collapse
-
by seqadmin
The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i
...-
Channel: Articles
01-24-2023, 01:19 PM -
-
by seqadminSingle-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.
The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes...-
Channel: Articles
01-09-2023, 03:10 PM -
ad_right_rmr
Collapse
Leave a comment: