How to determine 454 paired end adaptor sequence

[edge]

I have a list of 454 sequence data read, for running the preprocessing step, I need to find out the adaptor sequence read first.
Do anybody know how to find out the adaptor sequence for the 454 paired-end sequence?
Is it 454 company using a standard adaptor sequence for all of their sequencing process technique?

[maubp]

Passing on some information from a contact at Sanger regarding the paired end linker sequence:

454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

454titanium
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
(and also check for its reverse complement)

These are also given in the sffToCA documentation for the WGS assembler:

http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=Formatting_Inputs

[edge]

Thanks a lot for your explanation.
Do you have the list of paired-end adaptor sequence that using by 454 sequencing technique?
Can provide the suitable link or website for me to find out the paired-end adaptor sequence that using by 454 sequencing technique?
Thanks a lot for your help

Passing on some information from a contact at Sanger regarding the paired end linker sequence:

454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

454titanium
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
(and also check for its reverse complement)

These are also given in the sffToCA documentation for the WGS assembler:
http://sourceforge.net/apps/mediawik...matting_Inputs

[maubp]

The MIRA documentation gives a few adaptors, but warns that local sequencing centers may use their own specific ones:

http://chevreux.org/uploads/media/mira3_faq.html#section_10

[edge]

Hi, thanks a lot again
Do you have any idea about the adaptor sequence using by 454 technique to sequence bacillus genome?

The MIRA documentation gives a few adaptors, but warns that local sequencing centers may use their own specific ones:
http://chevreux.org/uploads/media/mi...tml#section_10

[maubp]

Are you talking about getting your own data for bacillus by paying a local sequencing service? If so, your sequencing center should be able to tell you the adaptor/linker sequences they use - but it will probably be the default Roche 454 sequences.

[edge]

For 454 FLX sequencing data,

The sequence below is it the general 454 flx adaptor sequence?
454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

When I using it because of palindromic, should I used this:

>454flx1
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC

>454flx2
CAACCTTGGCTTTCCCAAACTTAAGTTTGGGAAAGCCAAGGTTG

I just checked, my data is 454 flx sequencing data, just I not sure about its adaptor sequence used for 454 flx.
Thanks for your help

Are you talking about getting your own data for bacillus by paying a local sequencing service? If so, your sequencing center should be able to tell you the adaptor/linker sequences they use - but it will probably be the default Roche 454 sequences.

[maubp]

For 454 FLX sequencing data,

The sequence below is it the general 454 flx adaptor sequence?
454flx
GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
(palindromic)

No - that is the linker sequence used for paired end reads.

[edge]

thanks a lot, I get it d
you are administrator,right?!
thanks for your guide so far

No - that is the linker sequence used for paired end reads.

[maubp]

thanks a lot, I get it d
you are administrator,right?!
thanks for your guide so far

No, I'm not a forum admin - just another user.

I'm sorry if I added to the confusion by talking about the paired end linker sequences when you were more interested in the adapter sequences. Hopefully things are clearer now

[edge]

haha..
thanks a lot for your help
Actually I confusing myself d...
I refer to the paired-end linker instead of paired-end adaptor sequence
I misunderstanding myself d
Besides that, do you familiar with some open source software, like SSAHA2?!

No, I'm not a forum admin - just another user.

I'm sorry if I added to the confusion by talking about the paired end linker sequences when you were more interested in the adapter sequences. Hopefully things are clearer now