
No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Barcoded files, a lot of variance in supposed primers, help me understand

    So, I have this file with 1,314 sequences (file1) and another file with 566 sequences (file2). Each sequence has a proper barcode. What I can't understand is that in file1 the letters following the barcode are (number is count):


    However, in file2:

    The same forward primer 'ACGGGGCGCAGCAGGCGCGA' (the most abundant seq in file1) was used for both files. It's not even present in file2. How can this be? It's as if file2 is barcoded but the primer has been removed or something?
    Last edited by rhinoceros; 10-17-2013, 05:22 AM.

Latest Articles


  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin

    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    02-08-2024, 06:33 AM
  • seqadmin
    The 3D Genome: New Technologies and Emerging Insights
    by seqadmin

    The study of three-dimensional (3D) genomics explores the spatial structure of genomes and their role in processes like gene expression and DNA replication. By employing innovative technologies, researchers can study these arrangements to discover their role in various biological processes. Scientists continue to find new ways in which the organization of DNA is involved in processes like development1 and disease2.

    Basic Organization and Structure
    01-22-2024, 03:25 PM





Topics Statistics Last Post
Started by seqadmin, Yesterday, 08:57 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 02-12-2024, 03:37 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 02-09-2024, 03:36 PM
0 responses
Last Post seqadmin  