Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • 454 fasta files

    Hi all,
    I'm a bit confused with the 454 fasta output files after a sequencing run. Below you have an example what I got. According to that my 454 knowledge, capital letters were those with the higher quality scores, i.e. lowercase bases where those trimmed or filtered. But what about those lowercase bases with high quality scores?? (for instance those in bold).
    Finally I tried to perform an assembly process from the second fasta file, bu I suspect lost a lot of information.
    What do you think?
    Thanks a lot.
    >FF56QEU12HGEH6
    tcagGGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCC
    GTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTA
    TTATTATTATTATTATTTATTAAATTTCatgccgccctattccggaaactcaggg
    cgataacactgcagatatccttttttaccttaangtgtgtgtgtgtgtgtgtctt
    tgtgttgtatatataaataaaggtaaaaaggatatatgcagtgttatcttctatt
    tggtatgtacgtaaaacggg

    >uaccno=FF56QEU12HGEH6
    GGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCCGTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTATTATTATTATTATTAT
    TTATTAAATTTC

    >FF56QEU12HGEH6
    32 32 32 32 31 31 31 31 32 32 17 17 36 33 33 30 30 30 20 20 20 20 29 22 30 33 32 32 33 33 37 37 40 36 36 36 37 37 37 32 32 32 28 28 28 32 31 30 29 13 13 13 27 19 15 23 13 13 13 13 15 9 9 9 15 11 24 26 23 23 23 26 18 26 26 22 23 23 23 18 18 18 27 31 30 30 30 30 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 30 30 30 30 28 28 28 28 28 24 25 13 13 13 13 11 11 13 16 25 13 13 13 21 21 28 30 31 31 30 17 17 17 30 32 32 30 30 30 30 30 30 17 17 17 26 26 29 15 15 17 22 17 21 26 26 26 26 26 26 26 30 28 23 23 23 23 23 23 13 13 13 13 13 13 13 13 13 13 16 9 9 23 23 0 24 26 29 30 30 30 30 30 29 28 28 28 26 26 24 21 15 15 15 12 12 11 17 11 20 20 11 11 11 11 11 20 20 17 17 11 11 11 11 11 11 11 17 17 17 11 11 11 9 9 11 11 7 16 15 15 15 11 11 11 11 11 16 15 15 18 16 15 16 11 11 11 11 16 13 13 13 16 16 11 11 13 13 18 22 22 22 22 21 21 21 21 22 22 22 22

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
40 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
50 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
41 views
0 likes
Last Post seqadmin  
Working...
X