Announcement

Collapse
No announcement yet.

Illumina/Solexa Genome Analyzer Primer/Adapter Sequences

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #31
    I know a few people other than myself were looking for the concentrations of the Solexa v1.5 kit (and well all of them in my case) adapters. I spoke with a tech support person from Illumina and they told me the concentrations of the stock solutions before any of the dilutions were as such:

    3' sRNA Adapter v1.5 = 5µM
    SRA 5' Adapter = 5µM

    Other oligos:

    SRA RT primer = 100µM
    Primer GX1/2 = 25µM

    Hope that helps!

    -Joshua

    Comment


    • #32
      Hi - I am a bit confused about the Illumina Paired end adaptors..

      Are they a Y adaptor (illustrated below) where you have 2 primers which are complementary at the end you ligate to your library (ie i should only synthesise 2 oligos)

      Code:
      5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
                            |||||||||||||
      3'-GAGCCGTAAGGACGACTTGGCGAGAAGGCTAG-PO4-3'
      or are they two sets of fully complementary primers, so i should order 4 oligos? this is what it seems to illustrate in post #7

      Code:
      5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
         ||||||||||||||||||||||||||||||||
      3'-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAG-PO4-5'
      and
      5'-PO4-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3'
             ||||||||||||||||||||||||||||||||
         3'-TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTC-5'
      Cheers!

      Comment


      • #33
        Hi all,
        thank you for all the replies. It was very helpful.
        I have another question regarding MME cleavage. I use this protocol for library preparation(with MMEI cleavage): http://keck.med.yale.edu/microarrays...04241_RevA.pdf

        I'm experiencing trouble with the MME cutting procedure as it doesnt! cleave. Has anyone experienced this problem in the library preparation process. I use MME from NEB
        and tried various concentrations but without improvement...

        Thanks,

        Hilah

        Comment


        • #34
          frozenlyse,

          You would only synthesize the two oligos as in your first figure. Look at this thread http://seqanswers.com/forums/showthread.php?t=1169 (in particular the PDF attachment)

          Comment


          • #35
            Genomic PCR Oligo Mix

            so it's friday evening, and i was supposed to be amplifying my library before going home tonight however my coworker used all of our amplifying PCR Primers 2.1 and 1.1 for SE sequencing and I can't find an accurately labeled figure of the sequences for these SE PCR primers that Illumina sends out. I'm finding PE sequences everywhere though.

            clarification?

            Thanks.

            Originally posted by ECO View Post

            Sequences for Solexa Library Preparations:

            Genomic DNA oligonucleotide sequences

            Adapters 1
            5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
            5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

            PCR Primers 1
            5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
            5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

            Genomic DNA Sequencing Primer
            5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT


            DpnII gene expression oligonucleotide sequences

            Gex Adapter 1
            5' P-GATCGTCGGACTGTAGAACTCTGAAC
            5’ ACAGGTTCAGAGTTCTACAGTCCGAC

            Gex Adapter 2
            5' CAAGCAGAAGACGGCATACGANN
            5' P-TCGTATGCCGTCTTCTGCTTG

            Gex PCR Primer 1
            5' CAAGCAGAAGACGGCATACGA

            Gex PCR Primer 2
            5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

            Gex Sequencing Primer
            5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

            NlaIII gene expression oligonucleotide sequences

            Gex Adapter 1
            5' P-TCGGACTGTAGAACTCTGAAC
            5' ACAGGTTCAGAGTTCTACAGTCCGACATG

            Gex Adapter 2
            5' CAAGCAGAAGACGGCATACGANN
            5' P-TCGTATGCCGTCTTCTGCTTG

            Gex PCR Primer 1
            5' CAAGCAGAAGACGGCATACGA

            Gex PCR Primer 2
            5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

            Gex Sequencing Primer
            5' CCGACAGGTTCAGAGTTCTACAGTCCGACATG


            Small RNA oligonucleotide sequences

            RT Primer
            5' CAAGCAGAAGACGGCATACGA

            5' RNA Adapter
            5' GUUCAGAGUUCUACAGUCCGACGAUC

            3' RNA Adapter
            5' P-UCGUAUGCCGUCUUCUGCUUGUidT

            Small RNA PCR Primer 1
            5' CAAGCAGAAGACGGCATACGA

            Small RNA PCR Primer 2
            5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

            Small RNA Sequencing Primer
            5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

            **disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences!

            Comment


            • #36
              You can get the SE and PE PCR primer sequences from the supplementary info of Bentley et al 2009 (http://www.ncbi.nlm.nih.gov/pubmed/18987734). I pulled these and did a comparison of PE and SE primers/adapters (p 9 of attached pdf).

              Originally posted by der_eiskern View Post
              so it's friday evening, and i was supposed to be amplifying my library before going home tonight however my coworker used all of our amplifying PCR Primers 2.1 and 1.1 for SE sequencing and I can't find an accurately labeled figure of the sequences for these SE PCR primers that Illumina sends out. I'm finding PE sequences everywhere though.

              clarification?

              Thanks.
              Attached Files

              Comment


              • #37
                thanks greigite!

                Comment


                • #38
                  I am looking into making my own SE primers and noticed in the Bentley et al 2009 paper that they used phosphorothioate modified primers. Does anyone else who uses their own primers do this? Also, what purification for the oligos is needed? Standard desalting, PAGE, etc?

                  Comment


                  • #39
                    i just got HPLC purified phosphorothioate primers today in the post. I'll try to post how happy i am with them.

                    i've run into problems after gel purifying the ligated adaptors with inefficient amplification, hopefully this helps...

                    we'll see.

                    Comment


                    • #40
                      tgdeering, phosphorothioate fixed my problems. before i could barely see a band after amplification but with phosphorothioate primers i got maximal amplification with iProof.

                      Comment


                      • #41
                        New to this so my knowledge-base is still quite limited so be gentle in reply, please
                        We will prepare miRNA-Seq library and send it out for sequencing on a GAII. Can anyone confirm that these adapter/Primer sequences first reported by ECO have (can) been used successfully on the GAII (and presumably GAIIx)?

                        Small RNA oligonucleotide sequences
                        RT Primer
                        5' CAAGCAGAAGACGGCATACGA

                        5' RNA Adapter
                        5' GUUCAGAGUUCUACAGUCCGACGAUC

                        3' RNA Adapter
                        5' P-UCGUAUGCCGUCUUCUGCUUGUidT

                        Small RNA PCR Primer 1
                        5' CAAGCAGAAGACGGCATACGA

                        Small RNA PCR Primer 2
                        5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

                        Small RNA Sequencing Primer
                        5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

                        Was (is) there a GAI instrument? Does it require different Adapter/Primer sequences? Can't find any evidence of a GAI version on Illumina website.
                        Thanks in advance

                        Comment


                        • #42
                          Hi,
                          I am New to Illumina sequencing. This is a great resource!!! I was wondering if anyone has figured out the sequences of the multiplexing adaptors.

                          Thanks

                          Comment


                          • #43
                            Thanks for all the helpful stuff on here. A quick newbie question: are all these adapter sequences etc definitely unchanged across the various incarnations of Illumina (GAI, IIe, IIx) - I think so but not certain?
                            Thanks
                            bp

                            Comment


                            • #44
                              i can say the SE adaptors worked on my GAIIx SE sequencing runs last August with the latest kits at the time.
                              Last edited by der_eiskern; 02-04-2010, 11:25 AM. Reason: clarification

                              Comment


                              • #45
                                merging MAQ map files exceed limits

                                Dear all,

                                I have 45M (25M in pairs) aligned Solexa reads of 62 bp length in several map files after running Maq map. I have removed the duplicates and now I want to merge them, but get an error message that says that the size of the merged file becomes to big (> 2.1G). How I can get around this?

                                Are there scripts available that allow me to split the mapfiles according to chromosome number?


                                Kind regards
                                Henri Heuven
                                vet.fac.uu

                                Comment

                                Working...
                                X