Announcement

Collapse
No announcement yet.

i5 index read on NovaSeq

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • i5 index read on NovaSeq

    Hi

    I found the new NovaSeq index read a bit confusing. I have some libraries prep using the old TruSeq PCR primer without index. The company said that they were using v1.5 chemistry on NovaSeq, which should be the reverse method. But they read the "index sequence" on the old index-free TruSeq PCR1 primer as TCTTTCCC. I thought it should be AGATCTCG. They read the i5 on my new TruSeq N5xx primer as i predicted. Something is wrong. I put my PCR primers below:


    ​​​​​​>Old TruSeq_PCR1 (58nt)
    AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

    >new TruSeq N5xx with 8nt index
    AATGATACGGCGACCACCGAGATCTACACCGTCTAATACACTCTTTCCCTACACGACGCTCTTCCGATCT

    截屏2022-08-29 下午4.09.23.png
    source: https://jp.illumina.com/content/dam/...5057455-08.pdf

  • #2
    Nice

    Comment

    Working...
    X